Entry information : PpaPrx45
Entry ID 6318
Creation 2008-08-07 (Christophe Dunand)
Last sequence changes 2008-08-07 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx45
Name PpaPrx45
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx45
start..stop
S start..stop
PpaPrx44 399 1e-140 13..332 2..318
GbPrx04 349 1e-120 25..328 28..329
SmPrx56-2_33 347 6e-120 1..328 15..336
SmPrx56-1_5 347 6e-120 1..328 15..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 581273..581482 210 N° 2 581626..581817 192 N° 3 582237..582402 166 N° 4 582574..583004 431
join(581273..581482,581626..581817,582237..582402,582574..583004)


exon

Literature and cross-references PpaPrx45
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
DNA ref. Phytozome 12:   scaffold_112 (581273..583004)
Protein sequence: PpaPrx45
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332
PWM (Da):   %s   35921.95  
PI (pH):   %s   6.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALTLVTCVGGKILSVAATWDDSHLTPSFYDNKCPHLQKVVSSKVEAGRRRDQRLPASVLRLHFHDCFVNGCDGSILLDDRPGFVGEKSAAPNLNSARGFELIDDIKQDVEALCPDTVSCADILTIAARDSVALSGGPYWEVQLGRRDSLTASKTDAENSIPQPTFTVTQLVASFNAVGLNEKDVVALSGSHSFGKARCTSFQNRLGNQASGSQSPGSDPFLESSYLAKLQTLCPSNGDGNTTVNLDHFTPVHFDNQYYKNLQAAKGLLNSDAVLHTTNGQSNQLVEIYANDERVFFKDFAQSVLKMGSIKVMTGNKGEVRRNCRLPNTIRA

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Ecotype="Gransden 2004". Tandem with PpaPrx46.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTTACACTGGTGACATGTGTTGGTGGAAAAATTCTTTCGGTAGCTGCTACTTGGGATGACTCCCACCTCACCCCCTCCTTCTACGACAACAAATGCCCGCATCTGCAGAAAGTG
GTGTCTAGCAAGGTGGAGGCCGGAAGGCGGCGTGACCAGCGATTGCCAGCTTCCGTTCTGCGACTCCACTTCCATGATTGCTTTGTCAAC
GTAAACAGGCCCATTCTTGTCTATAATTAA
TGATGTTACGCTAGGCATGTTTGTCATATTACACGCATTGCTGCATGGTTAATCAAGAGGTCAACGACTCATTGATTTAACGATGGCTACCTATTCGAACATTTTCTCGGCAGGGGTGTG
ATGGATCCATCTTGCTCGACGACAGACCAGGCTTCGTAGGGGAGAAAAGTGCCGCCCCGAACTTGAACTCGGCGAGAGGGTTCGAATTGATCGACGATATCAAGCAAGATGTGGAGGCTT
TGTGTCCCGACACAGTCTCCTGTGCTGACATATTGACCATTGCAGCCCGGGACTCCGTTGCCTTG
GTGGGTAGCTAACTTCGCTGTCAGCTCATTTAGTTCTCAGACATTGTCACAACAG
TTTTACAGTATGGATCAATGACTGGGGAACCTATCAGTGTTACCCAGCCTCGAACATGAAACTCGTTGGTGGGAGGATGAATTAATGGATAATGATGAAGAATTCAGACTCCAGTTACAC
AAGTCAATCTGTGCATGCTAGTAGTTGGCTGTTGAGTGGTTGAGAAAGATAGTGTCAAAGTCAACCATGACCTGGTTGACTTCGGGGTCAACTTAGCAAGCTGTCTCTGTATCCTATCTA
GCCACGATACTCGCCGGATAATGAAGATTCACAACGAATTGGAAGCCTAATAATGGTACGCTCACAAGATCTGCAATATTAGTTGAAAATAGTTGATGTGTGTATTTGTGTGGGTGTTGA
CCAGAGTGGTGGCCCGTATTGGGAAGTACAGCTTGGCCGGAGAGACAGTCTGACAGCCAGCAAGACCGATGCGGAAAATTCCATCCCCCAGCCGACCTTCACCGTTACTCAGCTTGTTGC
TAGTTTCAACGCTGTTGGGCTCAATGAAAAAGACGTCGTTGCACTCTCAG
GTACTCCGACTAACACTTGATTTCCAAATGAGTCGACACGATAGACAGAAGGGTGAGTTTTATCAGGAAA
TGAAAAATCTGGTGATCATATCATTCAATTCAGGAACAAACAGTATTGGGTTCTAAAAAGTGAAGGCTTCTGCTGACTTCGACTTGGTATATATTTTCCAGGTTCGCATTCGTTTGGCAA
GGCAAGGTGTACTAGCTTCCAGAATCGTCTCGGAAACCAAGCTAGTGGTTCGCAGTCTCCAGGCTCAGATCCATTTCTGGAGAGCAGTTACCTTGCGAAGCTGCAGACTCTGTGTCCGTC
GAATGGAGACGGGAACACTACAGTCAATCTAGACCACTTCACTCCAGTCCATTTCGACAACCAGTATTACAAGAATCTGCAAGCTGCGAAGGGGCTGCTCAACTCAGACGCCGTGTTGCA
TACCACCAACGGCCAGAGCAACCAGCTTGTGGAAATTTATGCAAATGATGAACGCGTTTTCTTCAAGGACTTTGCCCAATCTGTGCTCAAGATGGGGTCGATTAAGGTGATGACTGGAAA
CAAGGGCGAGGTGCGTCGCAACTGCCGGTTACCGAATACTATTCGCGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTTACACTGGTGACATGTGTTGGTGGAAAAATTCTTTCGGTAGCTGCTACTTGGGATGACTCCCACCTCACCCCCTCCTTCTACGACAACAAATGCCCGCATCTGCAGAAAGTG
GTGTCTAGCAAGGTGGAGGCCGGAAGGCGGCGTGACCAGCGATTGCCAGCTTCCGTTCTGCGACTCCACTTCCATGATTGCTTTGTCAAC
GGGTGTGATGGATCCATCTTGCTCGACGAC
AGACCAGGCTTCGTAGGGGAGAAAAGTGCCGCCCCGAACTTGAACTCGGCGAGAGGGTTCGAATTGATCGACGATATCAAGCAAGATGTGGAGGCTTTGTGTCCCGACACAGTCTCCTGT
GCTGACATATTGACCATTGCAGCCCGGGACTCCGTTGCCTTG
AGTGGTGGCCCGTATTGGGAAGTACAGCTTGGCCGGAGAGACAGTCTGACAGCCAGCAAGACCGATGCGGAAAATTCC
ATCCCCCAGCCGACCTTCACCGTTACTCAGCTTGTTGCTAGTTTCAACGCTGTTGGGCTCAATGAAAAAGACGTCGTTGCACTCTCAG
GTTCGCATTCGTTTGGCAAGGCAAGGTGTACT
AGCTTCCAGAATCGTCTCGGAAACCAAGCTAGTGGTTCGCAGTCTCCAGGCTCAGATCCATTTCTGGAGAGCAGTTACCTTGCGAAGCTGCAGACTCTGTGTCCGTCGAATGGAGACGGG
AACACTACAGTCAATCTAGACCACTTCACTCCAGTCCATTTCGACAACCAGTATTACAAGAATCTGCAAGCTGCGAAGGGGCTGCTCAACTCAGACGCCGTGTTGCATACCACCAACGGC
CAGAGCAACCAGCTTGTGGAAATTTATGCAAATGATGAACGCGTTTTCTTCAAGGACTTTGCCCAATCTGTGCTCAAGATGGGGTCGATTAAGGTGATGACTGGAAACAAGGGCGAGGTG
CGTCGCAACTGCCGGTTACCGAATACTATTCGCGCTTGA

Retrieve as FASTA