Entry information : PpaPrx46
Entry ID 6319
Creation 2009-08-17 (Christophe Dunand)
Last sequence changes 2010-06-07 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx46
Name PpaPrx46
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx46
start..stop
S start..stop
PpaPrx47 514 0 1..327 1..326
PpePrx32 354 5e-123 30..327 22..316
EguPrx48 350 4e-121 30..327 22..318
MguPrx50 348 2e-120 10..327 2..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 584750..584974 225 N° 2 584353..584541 189 N° 3 583992..584151 160 N° 4 583450..583859 410
complement(join(583450..583859,583992..584151,584353..584541,584750..584974))


exon

Literature and cross-references PpaPrx46
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
DNA ref. Phytozome 12:   scaffold_112 (584974..583450)
Protein sequence: PpaPrx46
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (298)
PWM (Da):   %s   35132.13 (31975.3)  
PI (pH):   %s   9.24 (8.60) Peptide Signal:   %s   cut: 30 range:30-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEQRLRGGAWGVVLLLVRLMSLLHGTKALRVGFYNNICPGTETIVRQVVENRFSRDQSITPALLRLFFHDCFVTGCDASLLINSTPTNSAEKDAGANLTVRGFDLIDTAKAAVERVCPGMVSCADIIALATRDAVRLSGGPNFAMPTGRRDGRVSRADNVNLPGPTVSVADATRIFNAQGLTRNDMVTLLGAHSVGITHCSFFHERLWNFEGTGSADPSMDPNLVMRLKAICPQQGVGLGSPVNLDQATPNIMDNTFYNQLIARKGILQLDQRVATDRTTTARVNVLASPRSTFTAAFAASLIRLGNVRVIEGSGGEIRKICSRIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Ecotype="Gransden 2004". Tandem with PpaPrx45.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGCAAAGACTTAGGGGAGGGGCGTGGGGTGTGGTTTTATTGCTAGTGAGGTTGATGAGCTTGCTCCATGGAACGAAAGCATTGAGAGTAGGATTTTACAACAACATCTGCCCT
GGCACTGAAACGATTGTCAGGCAAGTAGTGGAGAATAGGTTCAGTAGGGACCAGTCCATTACGCCCGCTCTTCTACGGCTCTTCTTCCACGACTGCTTTGTCACG
GTGCTTGCCCAAACC
AAAGGTTTTTTTGATATTCCATATATGCTAATACGAGACGATGTTAAGATTAAAGTCAATCGACTTGTCTGTTATCGTATCGTTCATCACCACGTTTTGTTATCTACAAGCCACTTCTAG
CAGGATCTGAACAACAAATGTTGCACCAAAAACAACGTTCTAATTGTGCTAATTATGGCTTCTACGTTGGCAGGGGTGCGATGCTTCGTTGTTGATAAACAGCACACCCACTAATTCAGC
AGAGAAAGACGCAGGGGCGAACCTGACTGTCCGCGGTTTCGATCTCATTGACACCGCCAAAGCTGCCGTGGAGAGGGTCTGCCCTGGCATGGTGTCTTGCGCGGACATCATCGCATTGGC
AACCAGAGACGCCGTCAGGCTG
GTAAGAACTACACTAACGCGCATGATTGTTTATATACGACATTATCTTGGTTCTAATTGCCACACGCGGTAAACTCATTGATGTAGAGAAGCATCACT
CAGAATTGGCAACTCTCTGGAACAGCCAATCNNNNNNNNNNNNNNNNNNNNNCAATTCGCTTACTATTTGGGACAAAATGTGCATGAATTGTGGCCATTGCAGTCTGGAGGACCGAATTT
CGCAATGCCGACTGGTCGTAGAGATGGGCGCGTCTCCAGAGCTGACAATGTGAACTTGCCAGGCCCAACCGTGAGCGTGGCGGATGCCACCAGGATTTTTAATGCCCAAGGTTTGACAAG
GAACGACATGGTCACCCTTCTCG
GTAAATTAAACACGAATACCATAATACCAACTCCCAGCTCCATTTAAACGAGAGTTGGTTTCAGTTTTTGTCCAAATCCGGATTCGAGAGACAAATA
TTAACAGTCGAATTTCATGGGCTATTCTGTCGCAGGAGCTCACTCTGTCGGCATCACACACTGCAGCTTCTTCCATGAACGGCTCTGGAACTTCGAGGGAACTGGCAGTGCTGACCCATC
CATGGACCCCAACCTCGTGATGCGTCTCAAGGCGATCTGTCCGCAACAAGGAGTTGGACTGGGGAGTCCCGTGAACCTTGACCAAGCCACGCCCAACATCATGGACAATACGTTCTACAA
CCAGTTGATCGCAAGGAAGGGCATCTTGCAGCTGGACCAACGAGTGGCCACCGACAGGACCACTACAGCCCGAGTCAATGTCCTCGCATCACCCCGGTCTACTTTCACAGCCGCTTTTGC
GGCCTCACTCATCAGGCTCGGCAATGTGAGGGTGATTGAAGGAAGCGGTGGAGAAATCCGCAAGATTTGCAGCAGAATTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGCAAAGACTTAGGGGAGGGGCGTGGGGTGTGGTTTTATTGCTAGTGAGGTTGATGAGCTTGCTCCATGGAACGAAAGCATTGAGAGTAGGATTTTACAACAACATCTGCCCT
GGCACTGAAACGATTGTCAGGCAAGTAGTGGAGAATAGGTTCAGTAGGGACCAGTCCATTACGCCCGCTCTTCTACGGCTCTTCTTCCACGACTGCTTTGTCACG
GGGTGCGATGCTTCG
TTGTTGATAAACAGCACACCCACTAATTCAGCAGAGAAAGACGCAGGGGCGAACCTGACTGTCCGCGGTTTCGATCTCATTGACACCGCCAAAGCTGCCGTGGAGAGGGTCTGCCCTGGC
ATGGTGTCTTGCGCGGACATCATCGCATTGGCAACCAGAGACGCCGTCAGGCTG
TCTGGAGGACCGAATTTCGCAATGCCGACTGGTCGTAGAGATGGGCGCGTCTCCAGAGCTGACAAT
GTGAACTTGCCAGGCCCAACCGTGAGCGTGGCGGATGCCACCAGGATTTTTAATGCCCAAGGTTTGACAAGGAACGACATGGTCACCCTTCTCG
GAGCTCACTCTGTCGGCATCACACAC
TGCAGCTTCTTCCATGAACGGCTCTGGAACTTCGAGGGAACTGGCAGTGCTGACCCATCCATGGACCCCAACCTCGTGATGCGTCTCAAGGCGATCTGTCCGCAACAAGGAGTTGGACTG
GGGAGTCCCGTGAACCTTGACCAAGCCACGCCCAACATCATGGACAATACGTTCTACAACCAGTTGATCGCAAGGAAGGGCATCTTGCAGCTGGACCAACGAGTGGCCACCGACAGGACC
ACTACAGCCCGAGTCAATGTCCTCGCATCACCCCGGTCTACTTTCACAGCCGCTTTTGCGGCCTCACTCATCAGGCTCGGCAATGTGAGGGTGATTGAAGGAAGCGGTGGAGAAATCCGC
AAGATTTGCAGCAGAATTAACTAG

Retrieve as FASTA