Entry information : PpaPrx47
Entry ID 6320
Creation 2009-08-17 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx47
Name PpaPrx47
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx47
start..stop
S start..stop
PpaPrx46 505 0 1..326 1..327
CroPrx72 353 2e-122 12..326 6..323
PpePrx32 347 3e-120 30..326 22..316
PtaPrx03 347 4e-120 15..326 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 157692..157913 222 N° 2 157317..157505 189 N° 3 156963..157122 160 N° 4 156415..156824 410
complement(join(156415..156824,156963..157122,157317..157505,157692..157913))


exon

Literature and cross-references PpaPrx47
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
DNA ref. Phytozome 12:   scaffold_35 (157913..156415)
Protein sequence: PpaPrx47
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (297)
PWM (Da):   %s   34899.24 (31834.6) Transmb domain:   %s   i13-35o
PI (pH):   %s   10.29 (10.18) Peptide Signal:   %s   cut: 30 range:30-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAQRGRGGAFHLLLLLVSLMCVFHGTQGLRVGFYTNTCPNAETIVTQTVQNRFRRDKTITPALLRLFFHDCFVGCDASLLINSTPKNSAEKDAGANLTVRGYDLIDAAKAAVEKACPGKVSCADIIALATRDVIALSGGPKFAMPTGRRDGRVSKASNVNLPGPSLSVADATRAFTAQGMTQNDMVTLLGAHTVGITHCSFFDDRLWNFQGTGRADPSMDANLVKQLKSVCPQRGVGLGRPVNLDQGTPNIVDKVFYSQLLAKKGILQLDQRLATDRATSQRTRTLAGPTSPFTKDFVAAIIKLGNVKVLEGTKGEIRKICSRIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Ecotype="Gransden 2004". Tandem with PpaPrx46
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCGCAACGAGGACGAGGAGGAGCTTTCCATTTACTGCTGCTGCTGGTGAGTTTGATGTGCGTGTTCCATGGCACGCAAGGATTGAGGGTGGGGTTCTACACGAACACCTGCCCC
AATGCGGAAACCATCGTCACGCAGACCGTGCAGAACAGGTTCAGAAGAGACAAGACCATCACACCTGCTCTGCTGCGCCTCTTCTTCCACGACTGCTTTGTC
GTGGTACATGCCCGAACC
TGTTGGAATTCTAGTTATCTTTCCGGTGTGTCGAGTGTGAAATTTTCGAGTACATGATAAGGTGATGTTTTTTTAACTGTGAGTTACAAGGTGTGGTTGTTCATGAGAAGCTGGCTTGCC
CCACGACTAAGCTTCTGTTCATTTGAATTGCGATGTCCACATCGGCAGGGATGTGATGCTTCGTTGTTAATAAACAGCACACCCAAAAATTCAGCAGAGAAAGATGCAGGGGCCAACTTA
ACTGTTCGCGGCTACGACCTCATTGACGCCGCGAAAGCAGCGGTGGAGAAGGCCTGCCCTGGGAAGGTGTCTTGTGCGGATATCATCGCATTGGCTACCCGAGACGTCATTGCTCTG
GTA
TGTATCGTTGTAACTTTCCCACACCACCGTCATTACCCTCCACAGAGTCATTTCAAGCCCTACATTCATCAAACGTTATGGCGAATCCTGTGAATTTGGCAACCTCATGGCACATTGATA
TTTAAGGAAGCCTCTGTGTGAATTTATCTTCTGAGACAGATTCTGAAAAAAAACATTGTGATTTATTGCAGTCTGGAGGGCCGAAATTCGCAATGCCGACCGGTCGTCGAGACGGGCGCG
TCTCCAAAGCTTCCAATGTGAACTTGCCAGGCCCTTCACTGAGCGTGGCCGACGCGACCAGGGCTTTCACTGCCCAAGGCATGACCCAGAACGACATGGTTACCCTTCTCG
GTAAGCCAC
CAGTAATGCTCCCACCAGCTGCATCGAGCTGAATTGAGCAAGAACTGGACTAAGTTAACGAAAATTTTAGAAAAGTTTGTGCCCACCATCGGCCACTGATATGATTGCCGTGGTGGTTTT
TGGTTGCAGGAGCTCACACTGTGGGCATCACACACTGCAGCTTCTTTGACGATCGGCTGTGGAACTTCCAGGGAACTGGCCGTGCCGATCCATCCATGGACGCCAACCTTGTGAAGCAGC
TCAAGTCAGTGTGCCCGCAACGGGGTGTTGGACTGGGAAGACCAGTGAACTTGGACCAGGGCACGCCCAACATCGTCGACAAGGTGTTCTATAGCCAGTTGCTTGCTAAGAAGGGCATCC
TTCAGCTTGACCAACGGCTGGCCACCGACAGGGCCACTTCCCAAAGAACCAGAACCCTGGCAGGGCCTACGTCCCCTTTCACCAAAGATTTTGTGGCCGCGATCATCAAGCTCGGCAACG
TCAAGGTGTTGGAAGGAACCAAAGGAGAGATCCGCAAGATTTGCAGCAGAATTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCGCAACGAGGACGAGGAGGAGCTTTCCATTTACTGCTGCTGCTGGTGAGTTTGATGTGCGTGTTCCATGGCACGCAAGGATTGAGGGTGGGGTTCTACACGAACACCTGCCCC
AATGCGGAAACCATCGTCACGCAGACCGTGCAGAACAGGTTCAGAAGAGACAAGACCATCACACCTGCTCTGCTGCGCCTCTTCTTCCACGACTGCTTTGTC
GGATGTGATGCTTCGTTG
TTAATAAACAGCACACCCAAAAATTCAGCAGAGAAAGATGCAGGGGCCAACTTAACTGTTCGCGGCTACGACCTCATTGACGCCGCGAAAGCAGCGGTGGAGAAGGCCTGCCCTGGGAAG
GTGTCTTGTGCGGATATCATCGCATTGGCTACCCGAGACGTCATTGCTCTG
TCTGGAGGGCCGAAATTCGCAATGCCGACCGGTCGTCGAGACGGGCGCGTCTCCAAAGCTTCCAATGTG
AACTTGCCAGGCCCTTCACTGAGCGTGGCCGACGCGACCAGGGCTTTCACTGCCCAAGGCATGACCCAGAACGACATGGTTACCCTTCTCG
GAGCTCACACTGTGGGCATCACACACTGC
AGCTTCTTTGACGATCGGCTGTGGAACTTCCAGGGAACTGGCCGTGCCGATCCATCCATGGACGCCAACCTTGTGAAGCAGCTCAAGTCAGTGTGCCCGCAACGGGGTGTTGGACTGGGA
AGACCAGTGAACTTGGACCAGGGCACGCCCAACATCGTCGACAAGGTGTTCTATAGCCAGTTGCTTGCTAAGAAGGGCATCCTTCAGCTTGACCAACGGCTGGCCACCGACAGGGCCACT
TCCCAAAGAACCAGAACCCTGGCAGGGCCTACGTCCCCTTTCACCAAAGATTTTGTGGCCGCGATCATCAAGCTCGGCAACGTCAAGGTGTTGGAAGGAACCAAAGGAGAGATCCGCAAG
ATTTGCAGCAGAATTAACTGA

Retrieve as FASTA