Entry information : PpaPrx48
Entry ID 6321
Creation 2009-08-18 (Christophe Dunand)
Last sequence changes 2011-03-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx48
Name PpaPrx48
Class Class III peroxidase     [Orthogroup: Prx025]*
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx48
start..stop
S start..stop
PtaPrx03 244 5e-79 64..364 23..321
PgPrx04 244 5e-79 53..363 26..335
PabPrx42 235 1e-75 53..356 26..329
SmPrx19-1_79 234 2e-75 54..364 25..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1084910..1085224 315 N° 2 1085445..1085645 201 N° 3 1085768..1085933 166 N° 4 1086117..1086529 413
join(1084910..1085224,1085445..1085645,1085768..1085933,1086117..1086529)


exon

Literature and cross-references PpaPrx48
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
DNA ref. Phytozome 12:   scaffold_12 (1084910..1086529)
Protein sequence: PpaPrx48
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (342)
PWM (Da):   %s   39898.83 (37274.3) Transmb domain:   %s   i9-31o
PI (pH):   %s   10.1 (9.92) Peptide Signal:   %s   cut: 33 range:23-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRRDKHLRLLVTYIIFLLAANSFSSLLGEAASEKNTKKGGDQNGDQNVAAVPPAQASKLRYNHYRTTRCSKVESVVTTEVTKRSKRDPTLIAALLRLFFHDCFANKQCDASLLIKKMPKNEKTELHSGSNVGIKGLAFMDYLKTKVVESCNGSNIVSCADILALAARDAYVLASKRPAYPVLLGRLDGMVSLVKDADSLPGARTPINTIVSVFKDAGFTTEEAVILSGAHTIGEAKCKFFNDRLHNFLNTKKPDRTMDPALVEQLKKICPNMTANLESPAFLDQGTRRVFDKSYFVQVTRQRGVLQSDQNLFANAATKQFVTGLASGTEENFLSKFEKAMAKLGNLGATTNYKGNIRRVCSVLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Ecotype="Gransden 2004".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAGAGACAAGCACCTGCGCTTGTTGGTCACATATATTATATTTTTGCTGGCTGCGAATTCGTTCAGTAGTTTGTTGGGTGAAGCTGCTTCCGAGAAGAATACGAAGAAAGGCGGT
GATCAAAATGGTGATCAGAATGTAGCGGCTGTGCCTCCAGCCCAGGCCTCGAAACTGAGATATAATCACTATAGGACGACTAGATGCTCAAAAGTAGAGTCTGTAGTGACAACTGAAGTT
ACCAAGAGGTCCAAACGAGACCCTACTTTAATTGCTGCTCTGCTTCGCTTGTTCTTCCACGATTGCTTTGCCAAC
GTAAGTGCGTTTTCTACCTGATGCAATCTGCATTTAAGAGGTATT
GTCGTTGTTATTATGAGTTGGATAAATTTTCAGTGATAAGCTTGCCCTCAAATTGTATTCAAACTGAATTTTCACCGTCAATTGACTCATTTAATTAGGAAATAGTGAGGAATTGATAAT
TATTTGTGTTTTCCTGTACTTGCACTAATTTTGGATTCACGGAATGGATTATCAGAAACAATGTGATGCATCGCTACTGATTAAAAAAATGCCCAAAAACGAAAAAACGGAGTTGCATTC
CGGTTCGAACGTCGGTATCAAAGGCCTCGCATTCATGGATTACCTCAAGACTAAAGTGGTGGAATCGTGCAATGGTTCGAATATAGTATCATGCGCCGATATACTTGCTCTTGCAGCCAG
AGACGCTTACGTCCTG
GTAAGTATTCACAACTGAATAGGTTACCAAGTGTCTCATTCCTTGCTGGACACATATCACATGCGGAACTGAGATGTTTTATACATTCTCACAGAAAACATTCT
AACATGCAAGACTGACAGGCAAGCAAGCGTCCAGCGTATCCAGTACTGTTGGGACGACTCGATGGAATGGTGTCGCTCGTCAAGGATGCGGACTCCTTGCCTGGAGCTAGGACTCCCATA
AATACTATTGTCTCTGTATTCAAGGACGCCGGATTCACTACGGAAGAGGCTGTGATCCTTTCAG
GTAATCCATCTCTTCATGTGAAATTTGGACCCTGTGATGTACAGATTGCTGGGTGC
AGATTGCATGAAAATGGATTGACATACTGGATCGTCATGTGACAAGTCTAGATGCATTTAATGCTTAGTGTCCAGGATCTAAACTGTCTGTATCGAAACCTAATATTGGATCTACGACCA
TCTGCAGGAGCACACACCATTGGGGAAGCCAAGTGCAAGTTTTTCAACGATCGTCTCCACAACTTTTTGAACACCAAGAAGCCCGACAGGACCATGGATCCGGCTCTTGTAGAGCAGCTG
AAGAAGATCTGTCCCAACATGACAGCCAATTTAGAGAGCCCCGCATTCCTGGATCAAGGTACTCGCAGAGTGTTCGACAAGAGCTATTTCGTCCAGGTGACAAGACAAAGGGGTGTACTA
CAATCGGATCAAAACCTTTTCGCCAACGCAGCCACTAAACAATTCGTGACAGGTTTGGCCTCCGGGACGGAAGAAAACTTCTTGTCGAAATTCGAGAAGGCTATGGCCAAGCTTGGCAAC
CTGGGTGCTACCACGAATTACAAAGGCAACATTCGAAGAGTGTGTTCTGTTCTAAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAGAGACAAGCACCTGCGCTTGTTGGTCACATATATTATATTTTTGCTGGCTGCGAATTCGTTCAGTAGTTTGTTGGGTGAAGCTGCTTCCGAGAAGAATACGAAGAAAGGCGGT
GATCAAAATGGTGATCAGAATGTAGCGGCTGTGCCTCCAGCCCAGGCCTCGAAACTGAGATATAATCACTATAGGACGACTAGATGCTCAAAAGTAGAGTCTGTAGTGACAACTGAAGTT
ACCAAGAGGTCCAAACGAGACCCTACTTTAATTGCTGCTCTGCTTCGCTTGTTCTTCCACGATTGCTTTGCCAAC
AAACAATGTGATGCATCGCTACTGATTAAAAAAATGCCCAAAAAC
GAAAAAACGGAGTTGCATTCCGGTTCGAACGTCGGTATCAAAGGCCTCGCATTCATGGATTACCTCAAGACTAAAGTGGTGGAATCGTGCAATGGTTCGAATATAGTATCATGCGCCGAT
ATACTTGCTCTTGCAGCCAGAGACGCTTACGTCCTG
GCAAGCAAGCGTCCAGCGTATCCAGTACTGTTGGGACGACTCGATGGAATGGTGTCGCTCGTCAAGGATGCGGACTCCTTGCCT
GGAGCTAGGACTCCCATAAATACTATTGTCTCTGTATTCAAGGACGCCGGATTCACTACGGAAGAGGCTGTGATCCTTTCAG
GAGCACACACCATTGGGGAAGCCAAGTGCAAGTTTTTC
AACGATCGTCTCCACAACTTTTTGAACACCAAGAAGCCCGACAGGACCATGGATCCGGCTCTTGTAGAGCAGCTGAAGAAGATCTGTCCCAACATGACAGCCAATTTAGAGAGCCCCGCA
TTCCTGGATCAAGGTACTCGCAGAGTGTTCGACAAGAGCTATTTCGTCCAGGTGACAAGACAAAGGGGTGTACTACAATCGGATCAAAACCTTTTCGCCAACGCAGCCACTAAACAATTC
GTGACAGGTTTGGCCTCCGGGACGGAAGAAAACTTCTTGTCGAAATTCGAGAAGGCTATGGCCAAGCTTGGCAACCTGGGTGCTACCACGAATTACAAAGGCAACATTCGAAGAGTGTGT
TCTGTTCTAAATTAG

Retrieve as FASTA