Entry information : SsclAPx-CcP01
Entry ID 6331
Creation 2008-08-28 (Marcel Zamocky)
Last sequence changes 2012-02-28 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-05-11 (Christophe Dunand)
Peroxidase information: SsclAPx-CcP01
Name SsclAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Sclerotiniaceae Sclerotinia
Organism Sclerotinia sclerotiorum    [TaxId: 5180 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsclAPx-CcP01
start..stop
S start..stop
BfuAPx-CcP02 836 0 1..532 1..532
ApruAPx-CcP03 551 0 1..530 1..531
HC14APx-CcP02 524 0 1..533 1..541
BdotAPx-CcP02 504 1e-174 1..529 1..526
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1038777..1038918 142 N° 2 1038996..1040450 1455 N° 3 1040636..1040766 131  
join(1038777..1038918,1038996..1040450,1040636..1040766)


exon

Literature and cross-references SsclAPx-CcP01
Literature Reference #1: Amselem J., Cuomo C.A., van Kan J.A.L., Viaud M., Benito E.P., et al. (2011) Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS Genet. 7(8): e1002230
Protein ref. UniProtKB:   A7EB09
DNA ref. JGI genome:   Supercontig_2.3 (1038777..1040766)
mRNA ref. GenBank:   XM_001596225
Protein sequence: SsclAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   576 (557)
PWM (Da):   %s   63014.19 (61017.1)  
PI (pH):   %s   4.54 (4.51) Peptide Signal:   %s   cut: 20 range:20-576
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTQSLISMGLLPILSVNAAYTWPSKYDELEDILYLQAGYRRYGFRDGVTPCGFSADGSNRETAAEWIKTAYHDMATHDVETGLGGLDASIAYELGRAENPGSAFNGTFGFTNNYASIKSSNSDLLAMSVVVASMACGGPIIPFRAGRIDAVQAGVPGVPQPDQDLATHTAIFAKQGFNTTEMITMVACGHVLGGVHGVDFPQITGDNNETSFPHFNSQYDNFTNSIVTEYLEDKSIDVLVVGKNDTFNSDKRIFGADNNKTMTSLADPSNFQAQCRDIFARMIDTVPASVTLSEVITPIEVKPTELSLALGANNTLSFTGSIRVRTTHRNADNVTVSLRYRDRNNNLSNTTISTERGRWQLGQSYGFAREVFTFYEFDTAFDVTSSISSFDVIIHTAGEADEINTNNGLGFPVSDAILLQAPQSCQPQIIVNEAGQWNLTITAAVRADRVGEPVAFDWVYKRFIQGVMINQLEVQRTVMEKASEEIGGYYLYTATKPIDTVQWSTTFDLVLGEGDNVSKLEFLSTGNLASTSWLDEKVQEREDAHKTRRSAVGARDILYSILFDIVAATQHVLR

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="ATCC 18683/1980/Ss-1". On distal heme side deviations from consensus sequence. Signal sequence for secretion: pos.1-19.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACACAATCTCTAATCAGTATGGGCTTATTGCCTATACTATCAGTAAACGCAGCATATACCTGGCCTTCAAAATACGACGAATTAGAGGATATTCTTTACCTACAAGCAGGATAC
AGACGCTACGGATTTAGAGACG
GTAAGTCATTGGAAAAGAAAAGAAATATATATCTTCAGAAGTCATCCATCAGAGCACTTCACTAATTCCCAAAATAGGTGTTACACCATGTGGCTTCT
CAGCTGATGGTAGTAATCGAGAGACAGCTGCAGAATGGATCAAAACGGCTTACCATGATATGGCAACGCATGATGTAGAAACTGGTCTTGGAGGACTTGATGCTTCGATAGCTTATGAGC
TTGGTCGTGCAGAGAATCCCGGTTCGGCTTTCAATGGTACTTTTGGATTCACAAACAACTATGCCTCGATCAAATCGTCTAACTCTGATCTTCTCGCCATGTCTGTCGTTGTTGCCTCCA
TGGCATGCGGAGGTCCAATTATTCCATTTCGAGCTGGACGAATTGATGCCGTGCAGGCTGGTGTACCAGGTGTCCCTCAACCTGATCAAGATTTGGCCACGCACACTGCCATTTTCGCAA
AGCAGGGTTTCAACACTACCGAGATGATTACCATGGTAGCATGTGGACATGTTCTCGGAGGAGTTCATGGCGTCGATTTCCCTCAGATTACTGGTGATAATAACGAAACTAGTTTCCCAC
ATTTTAACAGCCAATACGACAACTTTACCAACTCCATCGTAACCGAATACCTAGAGGATAAATCAATCGACGTGCTTGTGGTTGGCAAAAACGACACCTTTAACTCCGACAAGCGTATCT
TCGGTGCTGATAACAACAAAACCATGACTTCTCTAGCAGATCCTTCTAATTTCCAAGCGCAGTGCCGCGACATTTTTGCCCGCATGATCGACACCGTTCCTGCAAGCGTCACACTTTCAG
AAGTCATCACCCCCATCGAAGTGAAGCCAACCGAGCTTTCCCTCGCCTTAGGCGCAAACAACACATTATCCTTCACAGGTTCTATCCGCGTGCGTACCACCCACCGCAACGCCGACAACG
TTACCGTATCCCTCCGCTACCGTGATCGCAACAACAACCTCTCAAACACCACCATCTCAACCGAACGCGGACGCTGGCAACTAGGCCAAAGCTATGGATTCGCCAGGGAAGTCTTCACCT
TCTATGAATTCGACACTGCTTTCGATGTTACATCCAGCATCTCATCTTTCGACGTCATCATCCATACAGCTGGCGAAGCTGATGAGATCAACACCAACAATGGCCTCGGATTTCCCGTCT
CAGACGCAATTCTTTTGCAAGCACCACAATCCTGTCAACCACAAATAATCGTGAATGAAGCAGGCCAATGGAATCTCACCATCACCGCCGCAGTCCGCGCCGATCGTGTCGGGGAACCTG
TAGCTTTCGACTGGGTTTACAAACGCTTCATCCAAGGCGTAATGATAAACCAATTGGAGGTACAACGTACGGTTATGGAGAAAGCGAGTGAGGAGATTGGTGGATATTATCTTTACACGG
CGACAAAGCCAATTGATACGGTACAGTGGTCGACAACATTTGACTTGGTATTGGGCGAGGGAGACAATGTCTCCAAGCTTGAGTTCCTGTCGACTGGAAACTTGGCCTCTACCT
GTCAGC
CTTTTCCTTAAGCTGAATAGGGGATTCGAATTTGTAATTGCATAATAATGAGACTGTTTCTTAATGATATATGAAATCTTAAACCAACGATTCCTTTTGATAAATGAGATTCTAAACCAA
TGATGCTTCTGATGATGTCTAAATCCTGGCTAAAAGCTGGATTCGTGAAAGTTAGATAGCCTGGTTGGACGAAAAGGTACAGGAGAGGGAAGATGCACACAAAACTAGGAGGAGTGCTGT
TGGTGCAAGGGATATCCTGTACTCGATATTATTCGATATAGTTGCAGCAACACAACATGTCCTCAGAATT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACACAATCTCTAATCAGTATGGGCTTATTGCCTATACTATCAGTAAACGCAGCATATACCTGGCCTTCAAAATACGACGAATTAGAGGATATTCTTTACCTACAAGCAGGATAC
AGACGCTACGGATTTAGAGACG
GTGTTACACCATGTGGCTTCTCAGCTGATGGTAGTAATCGAGAGACAGCTGCAGAATGGATCAAAACGGCTTACCATGATATGGCAACGCATGATGTA
GAAACTGGTCTTGGAGGACTTGATGCTTCGATAGCTTATGAGCTTGGTCGTGCAGAGAATCCCGGTTCGGCTTTCAATGGTACTTTTGGATTCACAAACAACTATGCCTCGATCAAATCG
TCTAACTCTGATCTTCTCGCCATGTCTGTCGTTGTTGCCTCCATGGCATGCGGAGGTCCAATTATTCCATTTCGAGCTGGACGAATTGATGCCGTGCAGGCTGGTGTACCAGGTGTCCCT
CAACCTGATCAAGATTTGGCCACGCACACTGCCATTTTCGCAAAGCAGGGTTTCAACACTACCGAGATGATTACCATGGTAGCATGTGGACATGTTCTCGGAGGAGTTCATGGCGTCGAT
TTCCCTCAGATTACTGGTGATAATAACGAAACTAGTTTCCCACATTTTAACAGCCAATACGACAACTTTACCAACTCCATCGTAACCGAATACCTAGAGGATAAATCAATCGACGTGCTT
GTGGTTGGCAAAAACGACACCTTTAACTCCGACAAGCGTATCTTCGGTGCTGATAACAACAAAACCATGACTTCTCTAGCAGATCCTTCTAATTTCCAAGCGCAGTGCCGCGACATTTTT
GCCCGCATGATCGACACCGTTCCTGCAAGCGTCACACTTTCAGAAGTCATCACCCCCATCGAAGTGAAGCCAACCGAGCTTTCCCTCGCCTTAGGCGCAAACAACACATTATCCTTCACA
GGTTCTATCCGCGTGCGTACCACCCACCGCAACGCCGACAACGTTACCGTATCCCTCCGCTACCGTGATCGCAACAACAACCTCTCAAACACCACCATCTCAACCGAACGCGGACGCTGG
CAACTAGGCCAAAGCTATGGATTCGCCAGGGAAGTCTTCACCTTCTATGAATTCGACACTGCTTTCGATGTTACATCCAGCATCTCATCTTTCGACGTCATCATCCATACAGCTGGCGAA
GCTGATGAGATCAACACCAACAATGGCCTCGGATTTCCCGTCTCAGACGCAATTCTTTTGCAAGCACCACAATCCTGTCAACCACAAATAATCGTGAATGAAGCAGGCCAATGGAATCTC
ACCATCACCGCCGCAGTCCGCGCCGATCGTGTCGGGGAACCTGTAGCTTTCGACTGGGTTTACAAACGCTTCATCCAAGGCGTAATGATAAACCAATTGGAGGTACAACGTACGGTTATG
GAGAAAGCGAGTGAGGAGATTGGTGGATATTATCTTTACACGGCGACAAAGCCAATTGATACGGTACAGTGGTCGACAACATTTGACTTGGTATTGGGCGAGGGAGACAATGTCTCCAAG
CTTGAGTTCCTGTCGACTGGAAACTTGGCCTCTACCT
CCTGGTTGGACGAAAAGGTACAGGAGAGGGAAGATGCACACAAAACTAGGAGGAGTGCTGTTGGTGCAAGGGATATCCTGTAC
TCGATATTATTCGATATAGTTGCAGCAACACAACATGTCCTCAGAATT

Retrieve as FASTA