Entry information : MgrNOx01 (NOX1)
Entry ID 6350
Creation 2008-09-18 (Christophe Dunand)
Last sequence changes 2008-09-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MgrNOx01 (NOX1)
Name (synonym) MgrNOx01 (NOX1)
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation N/D
Tissue type Mycelium
Inducers Growth
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value MgrNOx01
start..stop
S start..stop
EfeNOx 1008 0 5..553 9..557
NcNOx01 982 0 1..553 1..553
GzNOx01 971 0 5..553 9..557
CpurNOx01 954 0 5..553 9..557
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1477912..1478267 356 N° 2 1477421..1477830 410 N° 3 1476521..1477339 819 N° 4 1476376..1476452 77
complement(join(1476376..1476452,1476521..1477339,1477421..1477830,1477912..1478 267))


exon

Literature and cross-references MgrNOx01 (NOX1)
Literature Egan,M.J., Wang,Z.Y., Jones,M.A., Smirnoff,N. and Talbot,N.J. Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proc. Natl. Acad. Sci. U.S.A. (2007)
Protein ref. UniProtKB_Uniparc:   A4RE76
DNA ref. JGI genome:   Supercontig_6.21 (1478267..1476376)
Cluster/Prediction ref. UniGene:   Mgr.4300
Protein sequence: MgrNOx01 (NOX1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   553
PWM (Da):   %s   63082.02 Transmb domain:   %s   i16-38o53-75i96-118o138-160i173-195o
PI (pH):   %s   8.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVGEFLAKQLTAQKLFFNISFWGFHIGIFAYGWYKQFSDPRLAGLNTLTFSVWISRGAGLVLSVDGMLILLPVCRTIMRWIRPKIRFIPLDENIWFHRQIAYAMLIFSITHTAAHYVNFFNVERLQIRAQTAVQIHYAQPGGATGHMMLLCMLLMYTTAHHRIRQQSFETFWYTHHLFIPFFLGLYTHTVGCFVRDTVEPHSPFAGDEYWNHCIGYLGWRWELWTGGFYLLERLYREIRARRETKITRVVRHPDVVEIQFNKPSFKYKAGQWLFLQVPSVSKYQWHPFTITSCPYDPYVSVHVRQVGDFTKALGDATGAGAAQAKLYEGVDPMGMYEVALQNGQQMPMLRIDGPYGAPAEDVFENEIAVLIGTGIGVTPWASILKNIWHLRNGPNPPTRLRRVEFLWVCKDTSSFEWFQTLLSSLEQQSTDAAGLPGGNGVEFLKIHSYLTQKLDMDTTQNIVLNSVGAALDPLTELKSRTNFGRPNFAKLFASMRDGIMDRTYLSGLEGSMKTTVGVYFCGPSAAARDIKAACKTASVNEVEFRFWKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo VI, 3 introns) and 7 ESTs. Strain="70-15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGGTCGGAGAGTTCTTGGCTAAGCAGCTCACGGCGCAGAAGCTTTTCTTCAACATTAGCTTTTGGGGTTTCCACATAGGAATCTTTGCCTATGGTTGGTATAAGCAGTTTTCAGAC
CCCCGCCTGGCTGGTCTGAACACTCTTACGTTCTCCGTGTGGATTTCTCGAGGTGCCGGTCTGGTGCTTTCAGTCGATGGAATGTTGATTCTGCTGCCCGTCTGCCGAACGATCATGAGG
TGGATCAGGCCCAAGATCCGCTTCATCCCCTTGGACGAGAACATTTGGTTCCATCGGCAAATCGCATATGCCATGCTGATCTTTAGCATCACCCACACCGCCGCGCACTATGTCAA
GTAA
GCATTCCTTCGGCCGGGCGAAAAAAAAGGACAGGGAAAATACGGGCGAGACCAGGATACTAATGCACCACTGAACAGCTTCTTCAATGTCGAGAGATTGCAAATTCGTGCCCAAACCGCA
GTTCAGATTCACTACGCGCAGCCTGGTGGTGCCACCGGCCACATGATGCTGTTGTGTATGCTTCTCATGTATACCACAGCTCACCACAGAATTCGTCAGCAATCCTTCGAGACTTTCTGG
TACACTCACCACCTGTTTATCCCGTTCTTCCTCGGTCTCTACACCCACACTGTGGGATGCTTCGTGCGTGACACTGTCGAGCCTCACTCGCCTTTCGCTGGAGACGAGTACTGGAACCAC
TGTATCGGATACCTGGGTTGGCGCTGGGAGCTGTGGACTGGTGGCTTTTACCTGCTTGAGCGCCTTTACCGCGAGATCCGTGCCCGTCGTGAGACCAAGATTACCCGCGTCGTCCGCCAT
CCTTATG
GTGAGTTTTTTTTTTTCCTTTTTTTTCTCCTCTTTGGACCATCTATGGTTGGATTCTCAGTGCTAATACGTGATTCCGCAGACGTCGTCGAAATCCAGTTCAACAAGCCTTCT
TTCAAGTACAAGGCCGGCCAATGGCTCTTCCTGCAGGTGCCCAGCGTCTCAAAGTACCAATGGCACCCTTTTACCATTACTTCTTGCCCGTACGACCCCTATGTTTCGGTCCACGTTCGT
CAAGTCGGTGACTTTACCAAGGCTCTCGGTGACGCCACAGGTGCCGGAGCCGCCCAGGCCAAGCTCTATGAGGGAGTCGACCCTATGGGTATGTACGAGGTCGCGCTCCAGAACGGCCAA
CAGATGCCCATGCTCCGCATTGATGGTCCCTATGGTGCCCCTGCCGAGGACGTGTTTGAGAACGAGATTGCAGTCCTCATTGGAACTGGTATTGGTGTCACTCCTTGGGCCTCGATTCTC
AAGAACATTTGGCATCTGCGCAACGGCCCGAACCCGCCTACCCGTCTCCGACGTGTTGAGTTCCTCTGGGTTTGCAAGGACACCAGCTCGTTCGAGTGGTTCCAGACTCTTCTGTCCTCG
CTCGAGCAGCAGTCAACAGACGCTGCAGGTCTCCCCGGCGGCAACGGTGTCGAGTTCCTCAAGATTCACTCTTACCTTACTCAGAAGCTCGACATGGACACCACCCAGAACATCGTGCTC
AACTCGGTTGGCGCTGCCCTCGACCCTCTGACTGAGCTCAAGTCCCGCACCAACTTTGGTCGCCCCAATTTCGCCAAGCTGTTCGCCTCGATGCGTGATGGTATCATGGATAGGACATAT
CTGAGTGGTCTCGAGGGAAGCATGAAGACCACAGTGGGAGTCTACTTCTGCGGTCCTTCAGCAGCTG
GTACGTTTATCTTGGTCCCTATTCAAATCACGTAGTCATTATTCACTAACATT
CTTTTTTTTTCACAGCTCGCGATATCAAGGCTGCTTGCAAGACTGCATCCGTCAACGAAGTCGAGTTCCGCTTCTGGAAGGAGCATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGGTCGGAGAGTTCTTGGCTAAGCAGCTCACGGCGCAGAAGCTTTTCTTCAACATTAGCTTTTGGGGTTTCCACATAGGAATCTTTGCCTATGGTTGGTATAAGCAGTTTTCAGAC
CCCCGCCTGGCTGGTCTGAACACTCTTACGTTCTCCGTGTGGATTTCTCGAGGTGCCGGTCTGGTGCTTTCAGTCGATGGAATGTTGATTCTGCTGCCCGTCTGCCGAACGATCATGAGG
TGGATCAGGCCCAAGATCCGCTTCATCCCCTTGGACGAGAACATTTGGTTCCATCGGCAAATCGCATATGCCATGCTGATCTTTAGCATCACCCACACCGCCGCGCACTATGTCAA
CTTC
TTCAATGTCGAGAGATTGCAAATTCGTGCCCAAACCGCAGTTCAGATTCACTACGCGCAGCCTGGTGGTGCCACCGGCCACATGATGCTGTTGTGTATGCTTCTCATGTATACCACAGCT
CACCACAGAATTCGTCAGCAATCCTTCGAGACTTTCTGGTACACTCACCACCTGTTTATCCCGTTCTTCCTCGGTCTCTACACCCACACTGTGGGATGCTTCGTGCGTGACACTGTCGAG
CCTCACTCGCCTTTCGCTGGAGACGAGTACTGGAACCACTGTATCGGATACCTGGGTTGGCGCTGGGAGCTGTGGACTGGTGGCTTTTACCTGCTTGAGCGCCTTTACCGCGAGATCCGT
GCCCGTCGTGAGACCAAGATTACCCGCGTCGTCCGCCATCCTTATG
ACGTCGTCGAAATCCAGTTCAACAAGCCTTCTTTCAAGTACAAGGCCGGCCAATGGCTCTTCCTGCAGGTGCCC
AGCGTCTCAAAGTACCAATGGCACCCTTTTACCATTACTTCTTGCCCGTACGACCCCTATGTTTCGGTCCACGTTCGTCAAGTCGGTGACTTTACCAAGGCTCTCGGTGACGCCACAGGT
GCCGGAGCCGCCCAGGCCAAGCTCTATGAGGGAGTCGACCCTATGGGTATGTACGAGGTCGCGCTCCAGAACGGCCAACAGATGCCCATGCTCCGCATTGATGGTCCCTATGGTGCCCCT
GCCGAGGACGTGTTTGAGAACGAGATTGCAGTCCTCATTGGAACTGGTATTGGTGTCACTCCTTGGGCCTCGATTCTCAAGAACATTTGGCATCTGCGCAACGGCCCGAACCCGCCTACC
CGTCTCCGACGTGTTGAGTTCCTCTGGGTTTGCAAGGACACCAGCTCGTTCGAGTGGTTCCAGACTCTTCTGTCCTCGCTCGAGCAGCAGTCAACAGACGCTGCAGGTCTCCCCGGCGGC
AACGGTGTCGAGTTCCTCAAGATTCACTCTTACCTTACTCAGAAGCTCGACATGGACACCACCCAGAACATCGTGCTCAACTCGGTTGGCGCTGCCCTCGACCCTCTGACTGAGCTCAAG
TCCCGCACCAACTTTGGTCGCCCCAATTTCGCCAAGCTGTTCGCCTCGATGCGTGATGGTATCATGGATAGGACATATCTGAGTGGTCTCGAGGGAAGCATGAAGACCACAGTGGGAGTC
TACTTCTGCGGTCCTTCAGCAGCTG
CTCGCGATATCAAGGCTGCTTGCAAGACTGCATCCGTCAACGAAGTCGAGTTCCGCTTCTGGAAGGAGCATTTCTAG

Retrieve as FASTA