Entry information : BfuNOx01 (noxA)
Entry ID 6352
Creation 2008-09-19 (Christophe Dunand)
Last sequence changes 2008-09-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: BfuNOx01 (noxA)
Name (synonym) BfuNOx01 (noxA)
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Sclerotiniaceae Botryotinia
Organism Botryotinia fuckeliana (Botrytis cinerea Sclerotinia fuckeliana)    [TaxId: 40559 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value BfuNOx01
start..stop
S start..stop
EfeNOx 924 0 2..553 6..557
NcNOx01 913 0 1..553 1..553
GzNOx01 904 0 1..553 5..557
MgrNOx01 900 0 1..553 1..553
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 55019..55119 101 N° 2 55170..55424 255 N° 3 55474..55883 410 N° 4 55930..56733 804
N° 5 56837..56928 92  
join(55019..55119,55170..55424,55474..55883,55930..56733,56837..56928)


exon

Literature and cross-references BfuNOx01 (noxA)
Literature REFERENCE 1 Segmueller N., Kokkelink L., Giesbert S., Tudzynski P. NADPH oxidases are involved in vegetative differentiation and pathogenicity in Botrytis cinerea. Submitted (OCT-2007).
REFERENCE 2 Silva,E.M., Valdes,J., Holmes,D., Shmaryahu,A. and Valenzuela,P.D. Generation and analysis of expressed sequence tags from Botrytis cinerea. Biol. Res. 39 (2), 367-379 (2006).
Protein ref. UniProtKB:   B0BES1
DNA ref. JGI genome:   Supercontig_1.80 (55019..56928)
EST ref. GenBank:   EB811788 [Fragment]
Protein sequence: BfuNOx01 (noxA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   553
PWM (Da):   %s   63222.01 Transmb domain:   %s   i13-35o50-72i101-123o138-160i173-195o
PI (pH):   %s   8.05
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGAVQFLKEQTRGTKLLFNFLFHGFHVGLFALGWWKQASDPRLAGLNSLTFSVWISRGAGLVLSVDVALILLPMCRNILRYIRPKIKFLPLDESQWFHRQVAYSLLFWTIFHVAAHYVNFFNVEKTQIRPLTAIQIHYTEAGGITGHIMLLCMMLMYTTAHAKIRQQSFETFWYTHHLFIPFLLGMYTHATGCFVRDTADPFSPFDGENFWGHCLGYEGWRWELWGGGLYFLERVYREIRSRRETQIVRVVRHPDAMEIQFRKPSMKYKAGQWLFLNVPSVSREQWHPFTITSCPFDPYISIHIRQVGDFTRTLGDALGAGAAQAKLYDGVDPNGMYEVALENGQKMPDIRIDGPYGAPAEDVFENEVAVLIGTGIGVTPWASILKNIWHLRHGTNPPERLRRVEFIWVCKDTTSFEWFQVLLSSLEAQSQEAAGQPGNDGQEFLRIHTYLTQKLDIDTAQNIVLNSVGADVDPLTELKSRTNFGRPDFTKLFEGMRDGIMDKTYMSGLEGDFKTNVGVYFCGPNVAARSIKKACKNATTRDVNFSFWKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and 1 EST. Strain="B05.10" and ="A1".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGCTGTACAGTTTTTGAAGGAGCAGACTCGGGGAACTAAGTTGCTATTCAATTTCCTCTTCCATGGCTTTCACGTTGGCCTGTTTGCTTTGGGATGGTGAGTCTGCTTTCAATAT
ATTCGTTATCATTTGCTAATAAGTCATACAGGTGGAAGCAAGCTAGTGATCCTAGACTAGCGGGTTTGAATTCTCTAACATTCTCAGTATGGATATCGAGAGGTGCCGGTCTGGTGTTAT
CTGTAGATGTTGCATTGATCTTATTGCCCATGTGCCGCAATATCTTGAGGTACATTAGACCAAAGATCAAATTCTTACCACTTGATGAGTCTCAATGGTTTCATCGACAAGTAGCATACT
CATTATTATTCTGGACCATATTTCATGTAGCTGCTCACTATGTGAA
GTAAGTATTGCAAAATCCTACTTTCACTCAAATATTAACACTGAGGCAGTTTCTTCAACGTCGAAAAGACTCAA
ATCAGACCTTTGACTGCAATCCAAATTCACTATACCGAGGCTGGTGGTATCACCGGTCATATCATGCTACTATGCATGATGCTGATGTATACTACTGCCCATGCCAAAATTAGACAACAA
TCTTTCGAAACATTTTGGTACACGCATCATTTGTTTATTCCATTTTTGCTTGGAATGTATACACATGCTACGGGATGCTTCGTCCGCGATACTGCAGACCCATTTTCTCCATTTGATGGC
GAGAACTTCTGGGGTCATTGCTTAGGTTATGAAGGATGGCGTTGGGAGCTTTGGGGGGGTGGACTTTACTTCCTTGAGCGTGTGTATCGCGAAATCAGAAGTAGAAGAGAAACCCAAATT
GTTAGAGTCGTTCGTCATCCATATG
GTATGTCACATCCTAACCATCATCATTCGAAACTAACAGACTACAGATGCCATGGAAATTCAATTCCGAAAGCCATCGATGAAGTACAAGGCAGG
CCAATGGCTTTTTCTCAACGTCCCATCTGTTTCCCGTGAGCAGTGGCATCCATTCACCATCACATCATGCCCGTTCGACCCCTACATCTCTATCCACATCCGTCAAGTCGGTGACTTTAC
CCGAACCCTCGGTGACGCCCTCGGAGCTGGTGCCGCACAAGCGAAACTCTACGACGGTGTCGATCCCAACGGTATGTACGAAGTAGCCCTCGAAAACGGTCAAAAAATGCCCGACATCCG
CATAGATGGTCCCTACGGTGCTCCCGCTGAAGACGTCTTCGAAAATGAAGTGGCCGTTCTCATCGGTACAGGTATTGGCGTAACACCATGGGCATCCATCCTCAAAAATATTTGGCATCT
TCGCCACGGAACAAATCCTCCCGAGCGTCTTCGTCGAGTAGAGTTCATCTGGGTTTGTAAAGATACCACATCCTTCGAATGGTTCCAAGTCCTTCTTTCATCTCTGGAAGCACAATCTCA
AGAAGCAGCAGGACAACCTGGTAATGATGGGCAAGAATTTTTACGTATCCATACTTATTTGACCCAAAAGCTGGATATCGATACGGCGCAAAATATCGTACTAAACAGTGTTGGTGCGGA
TGTCGATCCATTGACTGAATTGAAATCGAGGACGAATTTCGGAAGACCGGACTTCACAAAATTATTTGAGGGCATGAGGGATGGGATTATGGATAAAACCTATATGTCTGGGTTGGAAGG
AGATTTTAAAACTAATGTTGGAGTTTACTTTTGTG
GTATGTTTTTCCCTGTTGTGTTATTTTTGTTCCACTTTCTTTCCCCTTCCTGCCCCTCTCAATACATTTTTGATTTTAACATGGA
TACTAACATTCTAAATAGGACCAAACGTAGCAGCCCGCTCCATCAAAAAAGCATGTAAGAATGCCACAACTCGCGATGTCAATTTTTCGTTTTGGAAAGAACATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGCTGTACAGTTTTTGAAGGAGCAGACTCGGGGAACTAAGTTGCTATTCAATTTCCTCTTCCATGGCTTTCACGTTGGCCTGTTTGCTTTGGGATGGTGGAAGCAAGCTAGTGAT
CCTAGACTAGCGGGTTTGAATTCTCTAACATTCTCAGTATGGATATCGAGAGGTGCCGGTCTGGTGTTATCTGTAGATGTTGCATTGATCTTATTGCCCATGTGCCGCAATATCTTGAGG
TACATTAGACCAAAGATCAAATTCTTACCACTTGATGAGTCTCAATGGTTTCATCGACAAGTAGCATACTCATTATTATTCTGGACCATATTTCATGTAGCTGCTCACTATGTGAA
TTTC
TTCAACGTCGAAAAGACTCAAATCAGACCTTTGACTGCAATCCAAATTCACTATACCGAGGCTGGTGGTATCACCGGTCATATCATGCTACTATGCATGATGCTGATGTATACTACTGCC
CATGCCAAAATTAGACAACAATCTTTCGAAACATTTTGGTACACGCATCATTTGTTTATTCCATTTTTGCTTGGAATGTATACACATGCTACGGGATGCTTCGTCCGCGATACTGCAGAC
CCATTTTCTCCATTTGATGGCGAGAACTTCTGGGGTCATTGCTTAGGTTATGAAGGATGGCGTTGGGAGCTTTGGGGGGGTGGACTTTACTTCCTTGAGCGTGTGTATCGCGAAATCAGA
AGTAGAAGAGAAACCCAAATTGTTAGAGTCGTTCGTCATCCATATG
ATGCCATGGAAATTCAATTCCGAAAGCCATCGATGAAGTACAAGGCAGGCCAATGGCTTTTTCTCAACGTCCCA
TCTGTTTCCCGTGAGCAGTGGCATCCATTCACCATCACATCATGCCCGTTCGACCCCTACATCTCTATCCACATCCGTCAAGTCGGTGACTTTACCCGAACCCTCGGTGACGCCCTCGGA
GCTGGTGCCGCACAAGCGAAACTCTACGACGGTGTCGATCCCAACGGTATGTACGAAGTAGCCCTCGAAAACGGTCAAAAAATGCCCGACATCCGCATAGATGGTCCCTACGGTGCTCCC
GCTGAAGACGTCTTCGAAAATGAAGTGGCCGTTCTCATCGGTACAGGTATTGGCGTAACACCATGGGCATCCATCCTCAAAAATATTTGGCATCTTCGCCACGGAACAAATCCTCCCGAG
CGTCTTCGTCGAGTAGAGTTCATCTGGGTTTGTAAAGATACCACATCCTTCGAATGGTTCCAAGTCCTTCTTTCATCTCTGGAAGCACAATCTCAAGAAGCAGCAGGACAACCTGGTAAT
GATGGGCAAGAATTTTTACGTATCCATACTTATTTGACCCAAAAGCTGGATATCGATACGGCGCAAAATATCGTACTAAACAGTGTTGGTGCGGATGTCGATCCATTGACTGAATTGAAA
TCGAGGACGAATTTCGGAAGACCGGACTTCACAAAATTATTTGAGGGCATGAGGGATGGGATTATGGATAAAACCTATATGTCTGGGTTGGAAGGAGATTTTAAAACTAATGTTGGAGTT
TACTTTTGTG
GACCAAACGTAGCAGCCCGCTCCATCAAAAAAGCATGTAAGAATGCCACAACTCGCGATGTCAATTTTTCGTTTTGGAAAGAACATTTCTAG

Retrieve as FASTA