Entry information : AeuKat02_Ae201684 (g9195.t1 / Ae201684_9195.1)
Entry ID 6377
Creation 2008-09-29 (Christophe Dunand)
Last sequence changes 2014-03-12 (Catherine Mathe)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2014-03-26 (Catherine Mathe)
Peroxidase information: AeuKat02_Ae201684 (g9195.t1 / Ae201684_9195.1)
Name (synonym) AeuKat02_Ae201684 (g9195.t1 / Ae201684_9195.1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Saprolegniaceae Aphanomyces
Organism Aphanomyces euteiches    [TaxId: 100861 ]
Cellular localisation N/D
Tissue type N/D
Inducers Infected host
Saprophytic growth
Repressor N/D
Best BLASTp hits
Perox score E-value AeuKat02_Ae201684
start..stop
S start..stop
PcapKat01 695 0 5..492 8..489
PiKat01 677 0 3..492 5..488
PcapKat03 664 0 3..492 5..488
TadKat01 623 0 7..490 26..501
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 770568..771875 1308 N° 2 771927..772016 90 N° 3 772060..772140 81  
join(770568..771875,771927..772016,772060..772140)


exon

Literature and cross-references AeuKat02_Ae201684 (g9195.t1 / Ae201684_9195.1)
Literature Madoui MA, Gaulin E, Mathé C, San Clemente H, Couloux A, Wincker P, Dumas B. AphanoDB: a genomic resource for Aphanomyces pathogens. BMC Genomics. 2007 Dec 20;8:471
Cluster/Prediction ref. AphanoDB:   Ae_3AL5336 [Fragment]   Ae_5AL6391 [Fragment]
Protein sequence: AeuKat02_Ae201684 (g9195.t1 / Ae201684_9195.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   493
PWM (Da):   %s   54890.95  
PI (pH):   %s   5.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSNVATYSSGAPLPPLGLTASQSAGPNGPLVLQDFALLDHLAHFDHERIPERVVHAKGAGAFGYFEVTHDISAICSAKMFSNVGKQTPVAARFSQVGGEQGSADSVRDPRGFALKFYTEDGNWDLVGNNTPIFFIRDPILFPSFIHTQKRHPSTHLKDPSMTWDFYSLRPESTHQVSFLFSDRGIPDGYRHMHGYGSHTFENINADGVVTYVKYHFHTSQGIQNLGVDDATALAGSNPDYAMQDLYEAIAREDFPSWALYIQTMTQAEADQHLTDKDLNPFDVTKVWSHKRYPLQPVGKLVLNRNPTNYFSEVEQLAFSPAHFVPGIQASPDKMLQGRLFSYSDTQRYRLGVNYQQIPVNRPVPPAPQNYQRDGFMTVDGNQGDAPNYFPNSSKGPDYASPPRNEAPSTLQAAQVGRYDTQDDDNFSQVGVFYREVLDDQARDRLAENIAQGLHLTKNVAIQDRAVANFTAVDSDYGERIKVHLEKLEQSK*

Retrieve as FASTA  
Remarks Complete sequence from genomic. scaffold20
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAGCAACGTCGCCACGTACAGCTCTGGAGCCCCCCTTCCACCCCTTGGATTGACAGCATCCCAGTCGGCTGGTCCGAATGGTCCTCTCGTTCTCCAAGACTTTGCGCTGCTGGAT
CACTTGGCCCACTTTGACCACGAACGCATTCCAGAGCGTGTCGTGCATGCCAAGGGGGCGGGGGCGTTTGGGTATTTTGAAGTCACGCACGACATTTCGGCGATTTGCAGCGCCAAAATG
TTTTCCAACGTTGGGAAACAAACGCCAGTCGCTGCGCGGTTTTCCCAAGTCGGTGGCGAACAAGGCAGCGCCGACAGCGTGCGCGATCCCCGTGGCTTTGCGCTGAAATTTTACACGGAA
GACGGCAATTGGGATTTGGTGGGCAACAACACGCCCATCTTTTTTATCCGCGACCCCATTCTCTTTCCAAGCTTTATTCATACGCAGAAGCGGCACCCGTCGACGCATTTGAAAGATCCT
TCGATGACTTGGGACTTTTATTCGCTTCGTCCTGAAAGCACCCACCAAGTGTCGTTTCTCTTTTCGGATCGTGGCATTCCAGACGGCTATCGCCACATGCACGGCTACGGCAGCCACACG
TTTGAAAACATCAACGCGGATGGCGTCGTCACGTATGTGAAATACCATTTCCATACATCACAAGGCATTCAAAACCTCGGCGTGGACGACGCGACCGCGCTGGCAGGATCCAATCCAGAC
TACGCGATGCAAGACTTGTACGAAGCGATCGCGCGAGAGGATTTTCCATCGTGGGCTTTGTACATTCAAACCATGACGCAAGCGGAAGCCGACCAGCATTTGACGGACAAGGACTTGAAT
CCATTCGATGTGACTAAAGTGTGGTCGCACAAACGGTATCCCCTTCAGCCCGTGGGCAAATTGGTCTTGAATCGCAACCCGACGAATTATTTCAGCGAAGTGGAGCAGCTTGCCTTCTCT
CCAGCGCATTTTGTCCCTGGAATTCAAGCGTCGCCTGACAAAATGCTCCAAGGGCGACTCTTTTCCTACTCGGACACGCAACGCTACCGTCTTGGAGTGAATTACCAGCAGATTCCAGTG
AATCGCCCCGTGCCCCCAGCGCCACAAAATTATCAACGCGACGGATTCATGACTGTCGATGGAAACCAAGGCGACGCTCCCAATTACTTTCCCAACAGCAGCAAAGGACCAGACTATGCG
TCACCACCAAGAAACGAAGCGCCCTCGACGCTGCAAGCTGCTCAAGTTGGCCGATATGACACCCAAGATGACGATAACTTTTCCCAAGTTGGAGTCTTTTACCGCGAG
GTGAGCAACCCT
CTCGGCCATCGGCTTTTTATTGACACGCTTGGGCTGTAGGTGCTTGATGACCAAGCACGTGACCGACTTGCTGAAAACATTGCTCAAGGTTTGCATTTGACGAAGAACGTGGCGATTCAA
GACCGCGCG
GTTAGTCCTTCCATTGACATTCCATGGCTGAGAGATTGTGTAGGTGGCGAATTTTACCGCCGTTGACAGCGACTATGGCGAACGTATCAAAGTCCATCTTGAAAAGTTGGA
GCAATCCAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAGCAACGTCGCCACGTACAGCTCTGGAGCCCCCCTTCCACCCCTTGGATTGACAGCATCCCAGTCGGCTGGTCCGAATGGTCCTCTCGTTCTCCAAGACTTTGCGCTGCTGGAT
CACTTGGCCCACTTTGACCACGAACGCATTCCAGAGCGTGTCGTGCATGCCAAGGGGGCGGGGGCGTTTGGGTATTTTGAAGTCACGCACGACATTTCGGCGATTTGCAGCGCCAAAATG
TTTTCCAACGTTGGGAAACAAACGCCAGTCGCTGCGCGGTTTTCCCAAGTCGGTGGCGAACAAGGCAGCGCCGACAGCGTGCGCGATCCCCGTGGCTTTGCGCTGAAATTTTACACGGAA
GACGGCAATTGGGATTTGGTGGGCAACAACACGCCCATCTTTTTTATCCGCGACCCCATTCTCTTTCCAAGCTTTATTCATACGCAGAAGCGGCACCCGTCGACGCATTTGAAAGATCCT
TCGATGACTTGGGACTTTTATTCGCTTCGTCCTGAAAGCACCCACCAAGTGTCGTTTCTCTTTTCGGATCGTGGCATTCCAGACGGCTATCGCCACATGCACGGCTACGGCAGCCACACG
TTTGAAAACATCAACGCGGATGGCGTCGTCACGTATGTGAAATACCATTTCCATACATCACAAGGCATTCAAAACCTCGGCGTGGACGACGCGACCGCGCTGGCAGGATCCAATCCAGAC
TACGCGATGCAAGACTTGTACGAAGCGATCGCGCGAGAGGATTTTCCATCGTGGGCTTTGTACATTCAAACCATGACGCAAGCGGAAGCCGACCAGCATTTGACGGACAAGGACTTGAAT
CCATTCGATGTGACTAAAGTGTGGTCGCACAAACGGTATCCCCTTCAGCCCGTGGGCAAATTGGTCTTGAATCGCAACCCGACGAATTATTTCAGCGAAGTGGAGCAGCTTGCCTTCTCT
CCAGCGCATTTTGTCCCTGGAATTCAAGCGTCGCCTGACAAAATGCTCCAAGGGCGACTCTTTTCCTACTCGGACACGCAACGCTACCGTCTTGGAGTGAATTACCAGCAGATTCCAGTG
AATCGCCCCGTGCCCCCAGCGCCACAAAATTATCAACGCGACGGATTCATGACTGTCGATGGAAACCAAGGCGACGCTCCCAATTACTTTCCCAACAGCAGCAAAGGACCAGACTATGCG
TCACCACCAAGAAACGAAGCGCCCTCGACGCTGCAAGCTGCTCAAGTTGGCCGATATGACACCCAAGATGACGATAACTTTTCCCAAGTTGGAGTCTTTTACCGCGAG
GTGCTTGATGAC
CAAGCACGTGACCGACTTGCTGAAAACATTGCTCAAGGTTTGCATTTGACGAAGAACGTGGCGATTCAAGACCGCGCG
GTGGCGAATTTTACCGCCGTTGACAGCGACTATGGCGAACGT
ATCAAAGTCCATCTTGAAAAGTTGGAGCAATCCAAATAA

Retrieve as FASTA