Entry information : PpaKat02
Entry ID 6405
Creation 2008-11-26 (Christophe Dunand)
Last sequence changes 2008-11-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: PpaKat02
Name PpaKat02
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue types Gametophore
Protonema
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaKat02
start..stop
S start..stop
PpaKat01 982 0 1..492 1..492
SsKat02_AU1 883 0 1..492 1..492
SsKat01_AU1 880 0 1..486 1..486
PsyKat01 872 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 116326..116340 15 N° 2 116726..117160 435 N° 3 117370..117552 183 N° 4 117691..117960 270
N° 5 118205..118468 264 N° 6 118646..118735 90 N° 7 118936..119157 222  
join(116326..116340,116726..117160,117370..117552,117691..117960,118205..118468, 118646..118735,118936..119157)


exon

Literature and cross-references PpaKat02
Literature Rensing S.A., et al., The physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science 319:64-69(2008).
Protein ref. UniProtKB:   A9U1M6
DNA ref. Phytozome 11:   scaffold_422 (116326..119157)
Cluster/Prediction ref. UniGene:   Ppa.3695
Protein sequence: PpaKat02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56867.17  
PI (pH):   %s   7.35
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSQYNTPFWTTNQGSPVWNNNNSLTVGPRGPVLLEDYHLVEKLAQFDRERIPERVVHARGASAKGFFEVTHDISHLTCADFLRAPGVQTPVIVRFSTVIHERGSPEAIRDPRGFAVKFYTREGNFDMVGNNIPVFFIRDGIKFPDMIHALKPNPKSHIQEAWRIMDFFSHVPESCNMFTFLFDDIGIPADYRHMEGFGVHTFKLINKAGKETYVKFHWKPTCGVKNLLDDEAVLVGGANHSHATQDLYDSIAAGNFPEWKLMIQTMNPADENKFEFDPLDDTKIWPEDRFPLQPVGRMVLNRNIDNFFAENEQLAFCPGVIVPGIYYSDDKMFQTRIFSYSDTQRHRLGPNYLMLPVNAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRFDPVRHSERVPISQSRLAGVREKAVIPKENNFQQAGERFRSFDPARQDRFIKRIVELLSDPRVTQEVRSVWFSYWMQCDRTLGQRIASQFSMKASM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns) and 127 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTAGGTGTTTCCTCACTTTCGCGATGTTCTTGACGCATCTTGGTCTTTGAGCGGTTCTTCAGACTGCGGTATGGCATTATTGATTTTCTATGAAGTGATCGTAGT
TTCTCTGCGAGTTTCGTTAAAAGCTTTGGGATTCGATTCGAAGAGTCGGAGCGTCCTCTGTTGGTTTGTCAATTTTTTTAATTGTGTTGAGTATTACCGTAGTTTTCAACCCTGATGTTG
GGTTTTCAAGATTGTAGAATGAATGTACGTGTCGTGCATATTCTTCTTCGTTGGTTTAAGGAATGTAGATTCTGTCCTCAAACAGGATTTTTATGCCTGCGACATGCCAGGCAACTGATC
GCTCACCTAATTTCTCCTTTCTGGAATGGTTAATTTGCAGTATCGACCATCGAGCCAATACAACACACCTTTCTGGACTACAAACCAGGGATCACCAGTATGGAACAACAATAACTCCTT
GACAGTTGGCCCAAGAGGACCCGTGCTTTTGGAGGACTATCACTTGGTGGAGAAGTTGGCCCAATTTGATAGAGAGCGTATCCCAGAACGTGTGGTACATGCCCGAGGTGCGAGCGCCAA
GGGTTTCTTCGAGGTTACACACGATATCTCGCATCTGACATGTGCTGATTTCTTGAGGGCCCCAGGTGTGCAGACCCCGGTGATTGTTCGCTTCTCCACTGTGATTCACGAAAGAGGTAG
CCCTGAGGCCATCCGCGACCCACGTGGGTTTGCCGTCAAATTTTACACTCGGGAGGGTAACTTTGACATGGTTGGCAATAATATTCCAGTCTTCTTCATCCGAGACGGTATTAAG
GTATC
TTCTACGCTTATTCTACGTGCCTTGTGGTACATGAGTTTGCACAAGTTAGCTGTAATATTTACAGAATCCTTCTGGTCAGATATTTGCGATGAAGAAAATAGCAGTTTCATACGATAGAA
GAAGTGACAAGCATAACTTAGGGTGATATGATGATGCTACTGGATCATTTCGGATCACTAAATATTGATATCAATTGTGTGCAGTTCCCTGACATGATCCACGCCTTGAAGCCAAACCCA
AAGAGTCACATCCAGGAGGCATGGCGAATAATGGACTTTTTCTCGCACGTTCCCGAATCCTGCAATATGTTTACTTTTCTGTTTGATGACATTGGTATTCCTGCCGACTACCGTCACATG
GAAGGTTTCGGTGTACATACTTTCAAG
GTACGTCTGGATATAATAATTGGTTCCAGCTGCGTCGGTCATAACAGAGTTTTTGCGCGTGCAGATGCTGAGTTTACCCTTGAAGATTTAATA
CTGTTCTTGGTGCAACCGTGCTCACAATGATGTTTCAACGTGCAGTTGATTAACAAGGCTGGAAAAGAAACCTATGTCAAGTTTCACTGGAAGCCTACATGCGGTGTGAAGAATCTGTTG
GACGATGAGGCTGTGCTAGTCGGTGGTGCTAACCACAGTCACGCTACTCAGGACCTGTATGACTCAATTGCTGCTGGCAACTTCCCCGAGTGGAAGCTGATGATTCAGACAATGAACCCA
GCTGACGAGAACAAGTTTGAGTTTGATCCTCTCGATGACACCAAGATCTGGCCTGAGGATAGGTTCCCTCTTCAG
GTATGCATAATTGTTTGGGTTATATAGAATTTATGAACTGAGGGT
TCTATGTGAATATTTACACTCTCAACGATCATGAATCATTTGAAACTGGCTTTACATCTGAGTCGAGAGAAGTTCCTTTAGTATAAAAATCCGTGGAGACTACTTTATTTACAATTTATT
TCATCGACTATCCTAGCTGGTGGTGTTTTTGTGGAGTAATGTTACTCCTCAATTGAGGATTGTACTTTTCTGTGTGCAGCCTGTAGGAAGGATGGTCCTGAACAGGAACATTGATAACTT
CTTTGCCGAGAATGAGCAGCTGGCTTTCTGCCCTGGTGTCATTGTTCCTGGTATCTACTACAGTGATGACAAGATGTTCCAAACACGTATTTTCTCATACTCAGACACCCAACGTCACCG
TTTGGGCCCTAACTATCTTATGTTACCCGTCAATGCTCCGAAGTGCGCTCATCACAACAATCACCATGAAGGATTCATGAACTTCATGCATCGTGACGAGGAG
GTGAAAGTCTGATTATC
CCTCTTTGTATGTTCTAATATGTCTAATGTTTTACCTTAGATTCTAGCGGTTGCTAGGGTACTCAGAAGTGCTTTGATATATGTATCAGTATTCATCTAAATTTCAAATACTACAGTTGC
ACTTCGAATGCTGACGTTGTGAATATGTTCAAATGTATAGGTGAACTACTTTCCTTCTCGATTTGATCCCGTTCGTCATTCGGAACGAGTCCCAATTTCTCAGTCAAGACTTGCAGGAGT
GAGAGAGAAG
GTAATTTTCCTGCCCATCTCTTATCGTTAAATATATAGGTATACCAAGAAAGAAAACTGAGCGTGAATAATTTAGGTGTTATTTAATACATATGGACTGAGCACAATCTT
TGCGTGTTGATAGATTGATAGCTTGAGAAACTCAAGAATTTTAAGTGATTGATAACAATTCACTGACTCAACAATGTATGATTGTGGCAGGCCGTTATTCCCAAGGAAAACAACTTCCAA
CAAGCTGGAGAGAGGTTCCGGTCCTTTGACCCTGCTCGTCAAGACCGATTTATTAAGCGTATTGTTGAGCTCCTGTCAGACCCCAGGGTGACTCAGGAAGTCCGTAGTGTGTGGTTCTCG
TACTGGATGCAGTGCGATAGGACTTTGGGTCAGAGAATTGCCTCACAGTTCAGTATGAAGGCGTCTATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGTATCGACCATCGAGCCAATACAACACACCTTTCTGGACTACAAACCAGGGATCACCAGTATGGAACAACAATAACTCCTTGACAGTTGGCCCAAGAGGACCCGTG
CTTTTGGAGGACTATCACTTGGTGGAGAAGTTGGCCCAATTTGATAGAGAGCGTATCCCAGAACGTGTGGTACATGCCCGAGGTGCGAGCGCCAAGGGTTTCTTCGAGGTTACACACGAT
ATCTCGCATCTGACATGTGCTGATTTCTTGAGGGCCCCAGGTGTGCAGACCCCGGTGATTGTTCGCTTCTCCACTGTGATTCACGAAAGAGGTAGCCCTGAGGCCATCCGCGACCCACGT
GGGTTTGCCGTCAAATTTTACACTCGGGAGGGTAACTTTGACATGGTTGGCAATAATATTCCAGTCTTCTTCATCCGAGACGGTATTAAG
TTCCCTGACATGATCCACGCCTTGAAGCCA
AACCCAAAGAGTCACATCCAGGAGGCATGGCGAATAATGGACTTTTTCTCGCACGTTCCCGAATCCTGCAATATGTTTACTTTTCTGTTTGATGACATTGGTATTCCTGCCGACTACCGT
CACATGGAAGGTTTCGGTGTACATACTTTCAAG
TTGATTAACAAGGCTGGAAAAGAAACCTATGTCAAGTTTCACTGGAAGCCTACATGCGGTGTGAAGAATCTGTTGGACGATGAGGCT
GTGCTAGTCGGTGGTGCTAACCACAGTCACGCTACTCAGGACCTGTATGACTCAATTGCTGCTGGCAACTTCCCCGAGTGGAAGCTGATGATTCAGACAATGAACCCAGCTGACGAGAAC
AAGTTTGAGTTTGATCCTCTCGATGACACCAAGATCTGGCCTGAGGATAGGTTCCCTCTTCAG
CCTGTAGGAAGGATGGTCCTGAACAGGAACATTGATAACTTCTTTGCCGAGAATGAG
CAGCTGGCTTTCTGCCCTGGTGTCATTGTTCCTGGTATCTACTACAGTGATGACAAGATGTTCCAAACACGTATTTTCTCATACTCAGACACCCAACGTCACCGTTTGGGCCCTAACTAT
CTTATGTTACCCGTCAATGCTCCGAAGTGCGCTCATCACAACAATCACCATGAAGGATTCATGAACTTCATGCATCGTGACGAGGAG
GTGAACTACTTTCCTTCTCGATTTGATCCCGTT
CGTCATTCGGAACGAGTCCCAATTTCTCAGTCAAGACTTGCAGGAGTGAGAGAGAAG
GCCGTTATTCCCAAGGAAAACAACTTCCAACAAGCTGGAGAGAGGTTCCGGTCCTTTGACCCT
GCTCGTCAAGACCGATTTATTAAGCGTATTGTTGAGCTCCTGTCAGACCCCAGGGTGACTCAGGAAGTCCGTAGTGTGTGGTTCTCGTACTGGATGCAGTGCGATAGGACTTTGGGTCAG
AGAATTGCCTCACAGTTCAGTATGAAGGCGTCTATGTAG

Retrieve as FASTA