Entry information : Hs1CysPrx02
Entry ID 6427
Creation 2008-12-14 (Christophe Dunand)
Last sequence changes 2011-01-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-28 (Christophe Dunand)
Peroxidase information: Hs1CysPrx02
Name Hs1CysPrx02
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx004]
Taxonomy Eukaryota Metazoa Chordata Mammalia Hominidae Homo
Organism Homo sapiens (human)    [TaxId: 9606 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Hs1CysPrx02
start..stop
S start..stop
Ptro1CysPrx02 421 1e-152 1..222 1..222
Pabe1CysPrx02 395 2e-142 1..222 1..224
Cja1CysPrx01 384 1e-137 1..222 1..224
Cja1CysPrx01-1 382 5e-137 1..222 1..224
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 188891427..188891621 195 N° 2 188891966..188892439 474  
join(188891427..188891621,188891966..188892439)


exon

Literature and cross-references Hs1CysPrx02
Literature Venter,J.C. et al., The sequence of the human genome. Science 291 (5507), 1304-1351 (2001)
DNA ref. GenBank:   NC_000004.1 (188891427..188892438)
Protein sequence: Hs1CysPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   222
PWM (Da):   %s   24777.26  
PI (pH):   %s   9.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPGGRLLGDVAPNFEANTTAGRVRFQDFLGNSLGILFSHPRDFTPVCTTELGRAAKLAPEFAKRNRITLSIDRVEDRLAWSKDINAYNGEESTEKLPFRIIHDKNRDLFILLGMLDPAEKDEKDMPVTARVVFVIGPDKKPKLSIIYLATTGRNFDEILRVVTSLQLTAEKRVATPVDWKVGDSVMVLPVIPEEEAKKLFLKGVFTKELPSGKKYLRPTPQP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 2 introns). No EST. AGGT(G)GGGGATAG
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGGAGGTCGGCTTCTTGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACCGCCGGCCGCGTCCGTTTCCAGGACTTTCTGGGAAACTCACTGGGCATTCTCTTCTCCCACCCT
CGGGACTTTACCCCAGTGTGCACCACAGAGCTTGGCAGAGCTGCAAAACTGGCACCGGAATTTGCCAAGAGGAAT
GTTAAGTTGATTGCCCTTTCTTTTTTCTTTCTTTTTCTTTTTCTT
TTTTTGAGACGGAGTCTTGCTCTGTCGCCCAGGCTGGAGTGCAGTGGTGCACTCTTGGCTCACTGCAATCTCGGCTCACTGCAATCTCTGCATCCTGGGTTTAAGCAATTCTCCTGCCTC
AGACTCCTGAGTAGCTAGGACTACAGGTGTGCGACACCACGCCCAGCTAATTTTTGTATCTTTAGTAGAGATGGGGTTTCACCATGTTGGTCAGGCTGGTTTTGAACTCCTGACCTCGTG
ATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCACACCTAGCGGATTACCCTTTCGATAGACCGTGTTGAGGACCGTCTTGCCTGGAGCAAGGATATCAATG
CTTACAATGGTGAAGAATCCACAGAAAAGTTACCTTTTCGCATCATCCATGATAAGAATCGGGACCTTTTCATCCTGTTGGGCATGCTGGATCCAGCGGAGAAGGATGAAAAGGACATGC
CTGTGACAGCTCGTGTGGTGTTTGTTATTGGTCCTGATAAGAAGCCGAAGCTGTCTATCATCTACCTGGCTACCACTGGCAGGAACTTTGATGAGATTCTCAGGGTAGTCACCTCTCTCC
AGCTGACAGCAGAAAAGAGGGTTGCCACCCCAGTTGATTGGAAGGTGGGGGATAGTGTCATGGTCCTTCCAGTGATTCCTGAAGAGGAGGCCAAAAAACTTTTCCTGAAAGGAGTCTTCA
CCAAGGAGCTCCCATCTGGCAAGAAATACCTCCGCCCCACACCCCAGCCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGGAGGTCGGCTTCTTGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACCGCCGGCCGCGTCCGTTTCCAGGACTTTCTGGGAAACTCACTGGGCATTCTCTTCTCCCACCCT
CGGGACTTTACCCCAGTGTGCACCACAGAGCTTGGCAGAGCTGCAAAACTGGCACCGGAATTTGCCAAGAGGAAT
CGGATTACCCTTTCGATAGACCGTGTTGAGGACCGTCTTGCCTGG
AGCAAGGATATCAATGCTTACAATGGTGAAGAATCCACAGAAAAGTTACCTTTTCGCATCATCCATGATAAGAATCGGGACCTTTTCATCCTGTTGGGCATGCTGGATCCAGCGGAGAAG
GATGAAAAGGACATGCCTGTGACAGCTCGTGTGGTGTTTGTTATTGGTCCTGATAAGAAGCCGAAGCTGTCTATCATCTACCTGGCTACCACTGGCAGGAACTTTGATGAGATTCTCAGG
GTAGTCACCTCTCTCCAGCTGACAGCAGAAAAGAGGGTTGCCACCCCAGTTGATTGGAAGGTGGGGGATAGTGTCATGGTCCTTCCAGTGATTCCTGAAGAGGAGGCCAAAAAACTTTTC
CTGAAAGGAGTCTTCACCAAGGAGCTCCCATCTGGCAAGAAATACCTCCGCCCCACACCCCAGCCTTAA

Retrieve as FASTA