Entry information : Ptro1CysPrx02
Entry ID 6428
Creation 2008-12-14 (Christophe Dunand)
Last sequence changes 2011-08-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-12 (Christophe Dunand)
Peroxidase information: Ptro1CysPrx02
Name Ptro1CysPrx02
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx004]
Taxonomy Eukaryota Metazoa Chordata Mammalia Hominidae Pan
Organism Pan troglodytes (chimpanzee)    [TaxId: 9598 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Ptro1CysPrx02
start..stop
S start..stop
Hs1CysPrx02 421 1e-152 1..222 1..222
Pabe1CysPrx02 391 7e-141 1..222 1..224
Cja1CysPrx01 379 5e-136 1..222 1..224
Cja1CysPrx01-1 377 4e-135 1..222 1..224
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 192690394..192690588 195 N° 2 192690933..192691406 474  
join(192690394..192690588,192690933..192691406)


exon

Literature and cross-references Ptro1CysPrx02
Literature Birren,B. et al., Chimpanzee Sequencing and Analysis Consortium. Initial sequence of the chimpanzee genome and comparison with the human genome. Nature 437 (7055), 69-87 (2005).
DNA ref. GenBank:   NC_006471.2 (192690394..192691405)
Protein sequence: Ptro1CysPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   222
PWM (Da):   %s   24425.91  
PI (pH):   %s   6.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPGGQLLGDVAPNFEANTTAGCIHFQDFLGNSLGILFSHPRDFTPVCATELGRAAKLAPEFAKKNRITLSIDRVEDCLAWSKDINAYNGEEPTEKLPFPIIHDKNPDLFILLGMLDPVEKDEKDMPVTARVVFVIGPGKKPKLSIIYPATTGRNFDEILRVVTSLQLTAEKRVATPVDWKVGDSVMVLPVIPEEEAKKLFLKGVFTKELPSGKKYLRPTPQP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 1 intron). No EST. Isolate="Yerkes chimp pedigree #C0471 (Clint)".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCGGAGGTCAGCTTCTTGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACTGCCGGCTGCATCCATTTCCAGGACTTCCTGGGAAACTCACTGGGCATTCTCTTCTCCCACCCT
CGGGACTTTACCCCAGTGTGCGCCACAGAGCTTGGCAGAGCTGCAAAACTGGCACCGGAATTTGCCAAGAAGAAT
GTTAAGTTGATTGACCTTTCTTTTTTCTTTATTTTTATTTTTCTT
TTTTTGAGACGGAGTCTTGCTCTGTCGCCCAGGCTGGAGTGCAGTGGTGCAATCTTGGCTCACTGCAATCTCGGCTCACTGCAATCTCTGCATCCTGGGTTTAAGCAATTCTCCTGCCTC
AGCCTCCTGAGTAGCTAGGACTACAGATGTGCAACAACACGCCCAGCTAATTTTTGTATCTTTAGTAGAGACGGGGTTTCACCATGTTGGTCGGGCTGGTTTTGAACTCCTGACCTCGTG
ATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCACCTAGCGGATTACCCTTTCGATAGACCGTGTTGAGGACTGTCTTGCCTGGAGCAAGGATATCAATG
CTTACAATGGTGAAGAACCCACAGAAAAGTTACCTTTTCCCATCATCCACGATAAGAATCCGGACCTTTTCATCCTGTTGGGCATGCTGGATCCAGTGGAGAAGGATGAAAAGGACATGC
CTGTGACAGCTCGTGTGGTGTTTGTTATTGGTCCTGGTAAGAAGCCGAAGCTGTCTATCATCTACCCGGCTACCACTGGCAGGAACTTTGATGAGATTCTCAGGGTAGTCACCTCTCTCC
AGCTGACAGCAGAAAAGAGGGTTGCCACCCCAGTTGATTGGAAGGTNGGGGATAGTGTCATGGTCCTTCCAGTGATTCCTGAAGAGGAGGCCAAAAAACTTTTCCTGAAAGGAGTCTTCA
CCAAGGAGCTCCCATCTGGCAAGAAATACCTCCGCCCCACACCCCAGCCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCGGAGGTCAGCTTCTTGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACTGCCGGCTGCATCCATTTCCAGGACTTCCTGGGAAACTCACTGGGCATTCTCTTCTCCCACCCT
CGGGACTTTACCCCAGTGTGCGCCACAGAGCTTGGCAGAGCTGCAAAACTGGCACCGGAATTTGCCAAGAAGAAT
CGGATTACCCTTTCGATAGACCGTGTTGAGGACTGTCTTGCCTGG
AGCAAGGATATCAATGCTTACAATGGTGAAGAACCCACAGAAAAGTTACCTTTTCCCATCATCCACGATAAGAATCCGGACCTTTTCATCCTGTTGGGCATGCTGGATCCAGTGGAGAAG
GATGAAAAGGACATGCCTGTGACAGCTCGTGTGGTGTTTGTTATTGGTCCTGGTAAGAAGCCGAAGCTGTCTATCATCTACCCGGCTACCACTGGCAGGAACTTTGATGAGATTCTCAGG
GTAGTCACCTCTCTCCAGCTGACAGCAGAAAAGAGGGTTGCCACCCCAGTTGATTGGAAGGTNGGGGATAGTGTCATGGTCCTTCCAGTGATTCCTGAAGAGGAGGCCAAAAAACTTTTC
CTGAAAGGAGTCTTCACCAAGGAGCTCCCATCTGGCAAGAAATACCTCCGCCCCACACCCCAGCCTTAA

Retrieve as FASTA