Entry information : ZmKat1 (cat1 / GRMZM2G088212 [6a])
Entry ID 6437
Creation 2008-12-23 (Cyril Jourda)
Last sequence changes 2008-12-23 (Cyril Jourda)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmKat1 (cat1 / GRMZM2G088212 [6a])
Name (synonym) ZmKat1 (cat1 / GRMZM2G088212 [6a])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation Peroxisomal
Tissue types Embryosac
Endosperm
Epicotyls
Glumes
Kernels
Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmKat1
start..stop
S start..stop
SbKat03 1012 0 1..492 1..492
OsKat02 991 0 1..492 1..492
VvKat02 914 0 1..492 1..492
ZaKat01 910 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 63565224..63565238 15 N° 2 63565396..63565492 97 N° 3 63566433..63566710 278 N° 4 63567406..63568182 777
N° 5 63568311..63568400 90 N° 6 63568563..63568630 68 N° 7 63568736..63568829 94 N° 8 63568941..63569000 60
join(63565224..63565238,63565396..63565492,63566433..63566710,63567406..63568182 ,63568311..63568400,63568563..63568630,63568736..63568829,63568941..63569000)


exon

Literature and cross-references ZmKat1 (cat1 / GRMZM2G088212 [6a])
Literature REFERENCE 1 Redinbaugh M.G., Wadsworth G.J., Scandalios J.G.Characterization of catalase transcripts and their differential expression in maize.Biochim. Biophys. Acta 951:104-116(1988)

REFERENCE 2 Guan L., Scandalios J.G. Characterization of the catalase antioxidant defense gene Cat1 of maize, and its developmentally regulated expression in transgenic tobacco. Plant J. 3:527-536(1993)
Protein ref. UniProtKB:   P18122
DNA ref. GenBank:   X60135
mRNA ref. GenBank:   NM_001111945
Cluster/Prediction ref. UniGene:   Zm.83587
Protein sequence: ZmKat1 (cat1 / GRMZM2G088212 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56589.17  
PI (pH):   %s   7.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSGSNSSFWTTNSGAPVWNNNSALTVGQRGPILLEDYHLIEKLAQFDRERIPERVVHARGASAKGFFEVTHDVSHLTCADFLRAPGVQTPVIVRFSTVVHERGSPETLRDPRGFAVKFYTRGNFDLVGNNMPVFFIRDGMKFPDMVHAFKPNPKTNLQENWRIVDFFSHHPESLHMFTFLFDDVGIPLNYRHMEGFGVNTYTLINRDGKPHLVKFHWKPTCGVKCLLDNEAVTVGGTCHSHATKDLYDSIAAGNYPEWKLYIQTIDLDHEDKFDFDPLDVTKTWPEDIIPLQPVGRMVLNKNVDNFFAENEQIAFCPAIIVPGIHYSDDKLLQTRIFSYADTQRHRLGPNYLMLPVNAPKCAHHNNHHDGFMNFMHRDEEVNYFPSRFDPARHAEKVPIPPRVLTGCREKCIIQKENNFKQAGERYRSFDPARQDRFIQRWVDALTDPRVTHEHRTIWISYWSCDAALGQKLASRLNLKPSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 6 introns), 4 mRNA and 150 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAAGGTGCTTTTTTTTCGATTTAGAATTCTTTCTTCATCGATTTTGCCCTATGTGCTAGATCCTCAAATCAATTCCGCATCTTGTTTCCGCCCTTGATTGATGCATTCG
CTCGTCTGACTTGATTGATGCGCTCGATCTGGGGGACTCTTCGTTCTTGCAGCACCGCCCGTCTAGTGGGAGCAACTCCAGCTTCTGGACCACCAACTCCGGCGCCCCCGTCTGGAACAA
CAACTCTGCCCTCACCGTCGGACAGCGAG
GTCAGACCACAACCCCTCTCTCTGTTTATCCTGTAGCTGACATGCTGCTGCCTTCATTTGTCTCGTCTCTCCATCCCGGTTTCATTTTCCC
TTGCACGATCCTGTATGTACTCACTATGTATGTAGCATATATGTTCTTGATTTGTGCGAGACCCATCCGAGGCATAAATGATCTGTTCTAGCTTTGCTTTGAGGCCTATTATTGCACCGT
GGAAGCCAGAGGATTTCGCTTCCCATCCATTCAAAGCTTGCATCTTGATGTGCTTTTAATTAATTTCCAGTGACTAATTTTGCCTGCTCTGTACATGCGGGTTGTCGTTGATTCACCTGT
CCGAATATCGTCAATGAATTTGAGACTTGCCCAAAGGACTTATTCCTTGTATCAGCTGTAAGGTGAAGCTTTTGTCCTGATATTTTTGCCAGTCGCTGTCGAACCATTACGTTACTTAAG
GGAAAGAAAGCACATTCCCGGTACGAAATGCCATCATGGAGTCATAGTGATAATCCTAGGTGAGGGACACTTGGAGAGTAGTAAAGTCAGCGGAGGGTAATCACAGTTAATTGTTACTGA
TACAGTGTGTTTACTTTCGATGGTTACCTGGGGTAGGTTAAATCACTGCTGGAAACCTTAATCCTTGGTTCTTCTTTGTTCAGAATGTATGACCGAGCTTTGAAAGTGATTGCAAGCCCT
GTTTGGCTCTTCTGAATGTCATTGTCAATTTGCCACAAAAAGTGTCCATCAATTGCAGGAACAGGATACATACAATATGCCTATCTGAAACCAATATGTTTCTATCAGAGTATATATGTC
AGAAATATGAGAAGCCTTTTGTTTTAGGAGTTTGTTTTATTGTATAGTACCTGCTTCACTTTCTGTTTTGGTGTTATTAGCTAACAATTGCTGATATATTGTTCCACACGATGTGTTTTT
CTTTGACAGGTCCAATCCTCCTTGAGGATTATCATCTAATCGAAAAGCTTGCTCAGTTCGACAGAGAACGTATCCCTGAACGTGTTGTGCATGCACGGGGAGCCAGTGCCAAGGGTTTCT
TTGAGGTCACTCATGATGTCTCTCACCTTACATGTGCTGATTTTCTCCGTGCTCCTGGGGTCCAGACACCTGTTATTGTCCGTTTCTCTACAGTTGTGCATGAGCGTGGAAGCCCTGAGA
CCTTGAGGGATCCACGTGGTTTTGCTGTCAAGTTCTACACCAGAGAG
GTACTGAGGATAAATTTTAACTCGCCTCCTAGGGGAAAGAGATACATGTCTTAACTGTTCTATTTTTTTTTGT
TATGTCTTAAAAAGAAACATTCTTTTTTAGAACCGTTGTGAGTTATATGATACATCTTGGCAAGTACTTTTCTGTCAATGTATGTTGTATGCATTCATGAAAGCATGTAATATCAAACGT
TTAGCTGATTTCAACTATTGCTTAGTGATGTGTACTTTAGCCCTGTAGATGGTCCTTGACATGAGCTGTTATTCAGACGAAATGATGTCTCTAGGTCATTTTTCTCATAGGAATGAACTG
TATCTTTCTTTTTTCTGTAATTGAAACTTAAGTTACCTCCTCCTGTTTAAGTTGACCTTTGACCTTGCCATGATGAACTTCTTTTTATGAAATTAAATTCTGATTACCTATTTGTGACGC
AGATATAAGTGCCTTTTGCTTAAAAGAACAGTACTCTGGGGCACCATAATGTGCGGTTTGTGTCCAGTATCAGTATAATCAAAGATATTTCATAACTGAATCCATCTCTGTCCAGTTTCC
CCTACATATTGTTGCGCTGTTTGTTTACATTCTTTTACAAATTGTTGGATGCCTTCAAGTGACCCAATTTTTAGAACACTTTATTGACCTTTTTATATCCAGAGGGATAGTATCTTATGG
TTTTCTTCATGCGTTTTTTCAGGGTAACTTTGACCTCGTGGGTAACAACATGCCTGTGTTTTTCATACGAGATGGGATGAAATTCCCTGACATGGTCCACGCTTTCAAGCCGAATCCAAA
GACCAATTTGCAGGAGAACTGGAGAATAGTAGATTTCTTCTCTCACCACCCAGAGAGCCTACACATGTTCACCTTCCTCTTTGACGATGTTGGCATCCCACTCAACTACAGGCACATGGA
GGGCTTTGGTGTCAATACCTACACCTTGATCAACAGGGATGGAAAGCCTCACCTTGTGAAATTCCATTGGAAGCCTACTTGTGGTGTGAAATGCTTGCTCGACAATGAAGCTGTGACTGT
TGGAGGCACCTGCCACAGCCATGCGACGAAGGATCTATATGATTCCATCGCAGCTGGGAATTACCCTGAATGGAAGCTCTACATCCAGACTATTGATCTTGACCATGAGGATAAGTTTGA
CTTTGACCCGCTCGATGTCACCAAGACCTGGCCTGAGGATATCATCCCGCTGCAGCCCGTTGGACGGATGGTCCTGAACAAGAACGTCGACAACTTCTTTGCAGAGAATGAACAGATTGC
TTTCTGCCCAGCGATTATTGTTCCTGGAATTCACTATTCTGATGATAAGCTGCTCCAGACGAGAATCTTCTCCTATGCTGATACCCAGAGGCACCGCCTTGGTCCAAACTATCTGATGCT
TCCTGTGAATGCACCAAAATGTGCCCACCACAATAACCACCATGATGGGTTCATGAACTTCATGCACAGGGACGAAGAG
GTACTATGTTCTTTGGAGTTCTTTTCCCCTTTTGCATGCAA
GTGTGGTGTAGGATGCATCTTACCTGTCGTCATAAGTAACATGTGGGAGTTCTCTGGCACTTATACCTATCCTCTCTGTTTCCTTAGGTGAACTACTTCCCTTCGAGGTTTGATCCCGCC
CGTCACGCGGAGAAGGTCCCCATTCCTCCCCGTGTTCTAACAGGCTGTCGTGAGAAG
GTGTGTATTAAGTTCCAACAGCGCCTTCATGTTATAATAATATTGAGTTATGGTGGGCTTGTG
GCTACATCGTTATACTACATAATGTAATGGTGAAGGAAGGTGAATCATCGTTGGAATTTTTCTTCCTTCTAAACCTTGCTTGTACTGTTGAATCTGCAGTGCATCATTCAGAAGGAGAAC
AACTTCAAGCAGGCTGGCGAGAGATATCGTTCCTTCGACCCTGCAAG
GTTTGCCCCCCACACCTCAGGCTGTCTGGTTTACAGGTATAGGACACTAAGCTGCTGCTTGCCTAAATTCAAG
TGTTTTGGTATCTGTCTATCTGATGATGACAGGCAAGACCGGTTCATCCAGCGATGGGTTGACGCACTGACAGACCCTCGCGTGACCCATGAACACCGTACCATTTGGATCTCCTACTGG
TCCCAG
GTATTCATTTTGTTGTTTGTTTGTTCTTGGTAAAAAATGCTCAGTGGACATGGACATTCGAACGCTTTATCCTGGTACTGAAACCATATTAATTGTCTGTGTGCGCTGCAGTGC
GACGCCGCTCTTGGCCAGAAGCTGGCTTCTAGGCTGAACCTGAAGCCGAGCATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAAGCACCGCCCGTCTAGTGGGAGCAACTCCAGCTTCTGGACCACCAACTCCGGCGCCCCCGTCTGGAACAACAACTCTGCCCTCACCGTCGGACAGCGAGGTCCAATC
CTCCTTGAGGATTATCATCTAATCGAAAAGCTTGCTCAGTTCGACAGAGAACGTATCCCTGAACGTGTTGTGCATGCACGGGGAGCCAGTGCCAAGGGTTTCTTTGAGGTCACTCATGAT
GTCTCTCACCTTACATGTGCTGATTTTCTCCGTGCTCCTGGGGTCCAGACACCTGTTATTGTCCGTTTCTCTACAGTTGTGCATGAGCGTGGAAGCCCTGAGACCTTGAGGGATCCACGT
GGTTTTGCTGTCAAGTTCTACACCAGAGAG
GGTAACTTTGACCTCGTGGGTAACAACATGCCTGTGTTTTTCATACGAGATGGGATGAAATTCCCTGACATGGTCCACGCTTTCAAGCCG
AATCCAAAGACCAATTTGCAGGAGAACTGGAGAATAGTAGATTTCTTCTCTCACCACCCAGAGAGCCTACACATGTTCACCTTCCTCTTTGACGATGTTGGCATCCCACTCAACTACAGG
CACATGGAGGGCTTTGGTGTCAATACCTACACCTTGATCAACAGGGATGGAAAGCCTCACCTTGTGAAATTCCATTGGAAGCCTACTTGTGGTGTGAAATGCTTGCTCGACAATGAAGCT
GTGACTGTTGGAGGCACCTGCCACAGCCATGCGACGAAGGATCTATATGATTCCATCGCAGCTGGGAATTACCCTGAATGGAAGCTCTACATCCAGACTATTGATCTTGACCATGAGGAT
AAGTTTGACTTTGACCCGCTCGATGTCACCAAGACCTGGCCTGAGGATATCATCCCGCTGCAGCCCGTTGGACGGATGGTCCTGAACAAGAACGTCGACAACTTCTTTGCAGAGAATGAA
CAGATTGCTTTCTGCCCAGCGATTATTGTTCCTGGAATTCACTATTCTGATGATAAGCTGCTCCAGACGAGAATCTTCTCCTATGCTGATACCCAGAGGCACCGCCTTGGTCCAAACTAT
CTGATGCTTCCTGTGAATGCACCAAAATGTGCCCACCACAATAACCACCATGATGGGTTCATGAACTTCATGCACAGGGACGAAGAG
GTGAACTACTTCCCTTCGAGGTTTGATCCCGCC
CGTCACGCGGAGAAGGTCCCCATTCCTCCCCGTGTTCTAACAGGCTGTCGTGAGAAG
TGCATCATTCAGAAGGAGAACAACTTCAAGCAGGCTGGCGAGAGATATCGTTCCTTCGACCCT
GCAAG
GCAAGACCGGTTCATCCAGCGATGGGTTGACGCACTGACAGACCCTCGCGTGACCCATGAACACCGTACCATTTGGATCTCCTACTGGTCCCAGTGCGACGCCGCTCTTGGCCAG
AAGCTGGCTTCTAGGCTGAACCTGAAGCCGAGCATGTAA

Retrieve as FASTA