Entry information : ZmKat3 (cat3 / GRMZM2G079348 [6a])
Entry ID 6439
Creation 2008-12-24 (Cyril Jourda)
Last sequence changes 2011-01-20 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmKat3 (cat3 / GRMZM2G079348 [6a])
Name (synonym) ZmKat3 (cat3 / GRMZM2G079348 [6a])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation Mitochondria
Tissue type Silks
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmKat3
start..stop
S start..stop
SpKat01 987 0 2..495 1..493
SbKat01 986 0 2..495 1..493
OsKat01 905 0 2..495 1..492
CclKat01 791 0 2..495 1..493
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 240105134..240105151 18 N° 2 240105263..240106672 1410 N° 3 240106766..240106825 60  
join(240105134..240105151,240105263..240106672,240106766..240106825)


exon

Literature and cross-references ZmKat3 (cat3 / GRMZM2G079348 [6a])
Literature REFERENCE 1 Abler M.L., Scandalios J.G. Isolation and characterization of a genomic sequence encoding the maize Cat3 catalase gene.Plant Mol. Biol. 22:1031-1038(1993)
REFERENCE 2 Redinbaugh M.G., Wadsworth G.J., Scandalios J.G. Characterization of catalase transcripts and their differential expression in maize. Biochim. Biophys. Acta 951:104-116(1988)
Protein ref. UniProtKB:   P18123
mRNA ref. GenBank:   M33103
Cluster/Prediction ref. UniGene:   Zm.4508
Protein sequence: ZmKat3 (cat3 / GRMZM2G079348 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 495
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
56512.15  
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.96
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TMDPTKFRPSSSHDTTVTTTNAGAPVWNDNEALTVGPRGPILLEDYHLIEKVAHFARERIPERVVHARGASAKGFFECTHDVTSLTCADFLRAPGVRTPVIVRFSTVIHERGSPETIRDPRGFAVKFYTREGNWDLLGNNFPVFFIRDGIKFPDVIHAFKPNPRSHVQEYWRVFDFLSHLPESLHTFFFLFDDVGVPSDYRHMEGFGVNTYTFVSAAGKAQYVKFHWKPTCGVRCILTDEEAALVGGRNHSHATQDLYDSIAAGSFPEWTLYVQVMEPDTEEQYDFDPLDDTKTWPEDLLPLRPVGRLVLDRNVDNFFNENEQLAFGPGLVVPGIYYSDDKMLQCRVFAYADTQRYRLGPNYLMLPVNAPRCAHHNNHYDGAMNFMHRDEEVDYYPSRHAPLRQAAPPTPLPPRPVAGRREKATIRKPNDFKQPGERYRSWDADRQDRFVRRFADSLGHPKVSQELRSIWIDLLAKCDASLGMKIATRLNMKANM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns), 5 mRNA and 131 ESTs. Cultivar="W64A". last short exon is not predicted by Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAATGGATCCTACCAAGGTGAGCTCAGTATACTCTGCTTCTTCTTCTTCCGTCATATCGATCTTTGATTTGAGATTCGTAGCTCAGTACCTGTTTTGTGTTGTTTACTTGTGTTGATTT
TGCTTGCAGTTCCGTCCGTCCAGCAGCCACGACACGACGGTGACGACGACGAACGCGGGCGCTCCTGTGTGGAACGACAACGAGGCGCTGACTGTGGGGCCTCGCGGTCCCATCCTGCTG
GAGGACTACCACCTGATCGAGAAGGTGGCGCACTTCGCGCGCGAGCGCATCCCGGAGCGCGTGGTGCACGCGCGCGGGGCCTCCGCCAAGGGCTTCTTCGAGTGCACCCACGACGTGACG
TCGCTGACGTGCGCCGACTTCCTGCGCGCGCCCGGCGTGCGGACGCCCGTGATCGTGCGCTTCTCGACGGTGATCCACGAGCGGGGGTCCCCGGAGACGATCCGCGACCCGCGCGGGTTC
GCCGTGAAGTTCTACACCCGCGAGGGCAACTGGGACCTGCTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATCAAGTTCCCCGACGTGATCCACGCGTTCAAGCCCAACCCG
CGGTCGCACGTGCAGGAGTACTGGCGGGTGTTCGACTTCCTGTCGCACCTCCCCGAGAGCCTGCACACCTTCTTCTTCCTCTTCGACGACGTGGGCGTGCCGTCCGACTACCGCCACATG
GAAGGGTTCGGCGTGAACACGTACACGTTCGTGAGCGCGGCGGGGAAGGCGCAGTACGTCAAGTTCCACTGGAAGCCGACGTGCGGCGTGCGGTGCATCCTGACGGACGAGGAGGCGGCG
CTGGTCGGGGGACGGAACCACAGCCACGCGACGCAGGACCTGTACGACTCCATCGCGGCGGGGAGCTTCCCGGAGTGGACGCTGTACGTGCAGGTGATGGAGCCGGACACGGAGGAGCAG
TACGACTTCGACCCGCTGGACGACACCAAGACGTGGCCGGAGGACCTGCTGCCGCTCCGCCCCGTGGGGAGGCTGGTGCTGGACAGGAACGTGGACAACTTCTTCAACGAGAACGAGCAG
CTGGCGTTCGGCCCGGGGCTGGTGGTGCCAGGGATCTACTACTCGGACGACAAGATGCTGCAGTGCCGGGTGTTCGCCTACGCCGACACGCAGCGCTACAGGCTGGGTCCCAACTACCTG
ATGCTGCCCGTCAACGCGCCGCGCTGCGCGCACCACAACAACCACTACGACGGCGCCATGAACTTCATGCACCGGGACGAGGAGGTGGACTACTACCCGTCCAGGCACGCGCCGCTGCGG
CAGGCGGCGCCGCCCACGCCACTGCCGCCCAGGCCGGTCGCGGGGAGGAGGGAGAAGGCAACCATACGCAAGCCCAACGACTTCAAGCAGCCAGGGGAGAGGTACCGCTCCTGGGACGCC
GACCGACAGGACCGATTCGTGAGGCGATTCGCCGACTCGCTCGGACACCCAAAGGTCAGCCAGGAGCTCAGGTCCATCTGGATAGACCTCCTCGCCAAG
GTACGTGGATGGCATGGCATG
GCAGTGCCACACGTGTTTTCGATCGATCTAGCTACTCATGCATGATATACGACGATTGCTTTGCATATGCAGTGCGACGCGTCGCTGGGGATGAAGATTGCCACCCGGCTCAACATGAAG
GCAAACATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAATGGATCCTACCAAGTTCCGTCCGTCCAGCAGCCACGACACGACGGTGACGACGACGAACGCGGGCGCTCCTGTGTGGAACGACAACGAGGCGCTGACTGTGGGGCCTCGCGGTCCC
ATCCTGCTGGAGGACTACCACCTGATCGAGAAGGTGGCGCACTTCGCGCGCGAGCGCATCCCGGAGCGCGTGGTGCACGCGCGCGGGGCCTCCGCCAAGGGCTTCTTCGAGTGCACCCAC
GACGTGACGTCGCTGACGTGCGCCGACTTCCTGCGCGCGCCCGGCGTGCGGACGCCCGTGATCGTGCGCTTCTCGACGGTGATCCACGAGCGGGGGTCCCCGGAGACGATCCGCGACCCG
CGCGGGTTCGCCGTGAAGTTCTACACCCGCGAGGGCAACTGGGACCTGCTGGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATCAAGTTCCCCGACGTGATCCACGCGTTCAAG
CCCAACCCGCGGTCGCACGTGCAGGAGTACTGGCGGGTGTTCGACTTCCTGTCGCACCTCCCCGAGAGCCTGCACACCTTCTTCTTCCTCTTCGACGACGTGGGCGTGCCGTCCGACTAC
CGCCACATGGAAGGGTTCGGCGTGAACACGTACACGTTCGTGAGCGCGGCGGGGAAGGCGCAGTACGTCAAGTTCCACTGGAAGCCGACGTGCGGCGTGCGGTGCATCCTGACGGACGAG
GAGGCGGCGCTGGTCGGGGGACGGAACCACAGCCACGCGACGCAGGACCTGTACGACTCCATCGCGGCGGGGAGCTTCCCGGAGTGGACGCTGTACGTGCAGGTGATGGAGCCGGACACG
GAGGAGCAGTACGACTTCGACCCGCTGGACGACACCAAGACGTGGCCGGAGGACCTGCTGCCGCTCCGCCCCGTGGGGAGGCTGGTGCTGGACAGGAACGTGGACAACTTCTTCAACGAG
AACGAGCAGCTGGCGTTCGGCCCGGGGCTGGTGGTGCCAGGGATCTACTACTCGGACGACAAGATGCTGCAGTGCCGGGTGTTCGCCTACGCCGACACGCAGCGCTACAGGCTGGGTCCC
AACTACCTGATGCTGCCCGTCAACGCGCCGCGCTGCGCGCACCACAACAACCACTACGACGGCGCCATGAACTTCATGCACCGGGACGAGGAGGTGGACTACTACCCGTCCAGGCACGCG
CCGCTGCGGCAGGCGGCGCCGCCCACGCCACTGCCGCCCAGGCCGGTCGCGGGGAGGAGGGAGAAGGCAACCATACGCAAGCCCAACGACTTCAAGCAGCCAGGGGAGAGGTACCGCTCC
TGGGACGCCGACCGACAGGACCGATTCGTGAGGCGATTCGCCGACTCGCTCGGACACCCAAAGGTCAGCCAGGAGCTCAGGTCCATCTGGATAGACCTCCTCGCCAAG
TGCGACGCGTCG
CTGGGGATGAAGATTGCCACCCGGCTCAACATGAAGGCAAACATGTGA

Retrieve as FASTA