Entry information : MtAPx04 (Medtr5g064610.1[4.0] / Medtr5g073820.1[3.0])
Entry ID 6447
Creation 2008-12-31 (Christophe Dunand)
Last sequence changes 2008-12-31 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-31 (Messaoudi)
Peroxidase information: MtAPx04 (Medtr5g064610.1[4.0] / Medtr5g073820.1[3.0])
Name (synonym) MtAPx04 (Medtr5g064610.1[4.0] / Medtr5g073820.1[3.0])
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Leaves
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtAPx04
start..stop
S start..stop
GmAPx13 554 0 1..353 1..347
GmAPx14 538 0 1..353 1..340
VvAPx07 537 0 1..353 1..344
PpeAPx05 535 0 1..353 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27146341..27146442 102 N° 2 27145917..27146027 111 N° 3 27145507..27145591 85 N° 4 27145374..27145408 35
N° 5 27145189..27145254 66 N° 6 27145058..27145098 41 N° 7 27144570..27144700 131 N° 8 27144116..27144222 107
N° 9 27143386..27143523 138 N° 10 27142706..27142840 135 N° 11 27142481..27142591 111  
complement(join(27142481..27142591,27142706..27142840,27143386..27143523,2714411 6..27144222,27144570..27144700,27145058..27145098,27145189..27145254,27145374..2 7145408,27145507..27145591,27145917..27146027,27146341..27146442))


exon

Literature and cross-references MtAPx04 (Medtr5g064610.1[4.0] / Medtr5g073820.1[3.0])
DNA ref. Phytozome 12:   chr5 (27146442..27142481)
EST ref. GenBank:   EV256194.1 [5' end]   BQ157931 [Fragment]
Cluster/Prediction ref. Phytozome Gene 12:   31086240 UniGene:   Mtr.8490
Protein sequence: MtAPx04 (Medtr5g064610.1[4.0] / Medtr5g073820.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353
PWM (Da):   %s   38765.82  
PI (pH):   %s   7.93
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVSFLSISTLPSLHPLGGSHYPKTTSTRHQPRSVSICCAKIKTDVSDEEEQFFHWRRRDVLKCIGLTIGLESISSSGSLLGTANAADLIERRQRSDFQSQIKGTLYTAIANPDLTPSILTLALNDALTYDKATKTGGPNGSIRFSSEISRPENKGLSAALNFIEEAKKEIDSYSKGGPISYADLIQYAQSATKAQFLASAIRKCGGNEEKGNLLYTAYGSNGQWGLFDRQFGRTDTDEADPEGRIPLWEKASVQEMKDKFSAVGFGPRLAVLSAFIGPDQDATETLLASDPDVAPWVQKYQRSRETVSRTDYEVDLITTFTKLSTLGQKINYEAYTYPRKKIDITKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 10 introns) and 16 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTCTCTTTCCTCTCAATCTCAACTCTTCCTTCTCTTCATCCACTTGGTGGTTCTCATTATCCAAAAACAACTTCAACCAGACACCAACCTCGTTCAGTAAGTCTTTGTTACATA
CATTACAATGTCCTTTCTTAGATGTACATATTATGTGAATTCTGAATGATGATAATATGTTTTGGAACTTTGCATTAAAAAAAATAGATAAAGTCAATGTATGTTTGGATTGACAGTTAG
TTTGATAGAATCATGATTTGATCATAAGTTATACTTTGGAGCTTTAACAAAATCATGGTGTCACTGTGATTTCATCAAGCTCAATGGTTCCAAGCATTCACTCAATCATATTGGTTGCAA
TTGTTGCTTAGTTATGAATAATTTGAATTTGAAATAACATTGGTTTTGTTTTTAGGTGTCCATTTGTTGTGCAAAAATCAAGACTGATGTTAGCGATGAAGAAGAACAGTTCTTCCATTG
GAGGCGAAGAGACGTTCTTAAATGCATTGGGTTGACCATTGGTTTG
GTAAGAGTCATTATTTTGAATTGTTGGTAACAAATGTATTTCTTGTAAGGTTGATCAACGTCTTTACTAGTTCT
TTTTATTTTTATTTCCTTATAAAATGTAAATTTAGTGTTGTTTGAGTTTGGTAAAAGACCTCTTATGCTGAGAAATCATCACAAAGTAGTGCAGGTAGGAAACTTTGGGATAAAACAATG
CACACCATCATATTTTCATCTTGATCAACCAAAAATTTGAGCTGAAATATTTTATATATTATTATTGGATATGTATTTAGTGGATAAGATTGATTTGATGATGAGTTTCGGTCAGTTGCA
TCTGTTTGTAGGAGTCGATATCAAGCTCTGGATCGCTCCTTGGAACCGCTAATGCTGCTGATCTAATAGAACGCAGACAGCGCTCTGATTTTCAGTGTAAGATTCTTAGGTTTTACAACT
CCATGTGATCATTAATCATGTCAAACTCAATGGTTCTTTCATTTTAGCAGAGTTCTAACTTTCTGTTCTTACAGCTCAAATTAAAGGGACGCTATATACAGCAATAAAGGTATAGTTTGC
TGACTTGCATTTACTGAATGGTTATGGATTATACATTTGTCTTTTCCAGCTAGAGAATAGAATTTCCAATTTGGATATGAGCTTATTCGACGTTTGATATCTCTTCAGGCAAATCCTGAT
CTTACTCCATCCATTCTAACACTGGCTCTAAATGATGCTTTGACTTATGATAAG
GTGAGAGACGCGCGCTCGCACCCACATACATGCATGAACAGATATATCTATATTTCATCTGTATTG
ATTGGAATCTTCTTAAGTTTGTAGGCAACGAAAACGGGTGGCCCAAATGGTTCTATCCGGTTCAGGTACTTTTTTTTTTTGTAATTAACATTCAAATCCAATGATGTTAACATATGTATA
AGTATAACCATAGATGTAGTCTTTAATTCTTTTTAGAAACAGTTAGTCTTCTAAATAAGGTACTCTAAGATTGTTATTGCATTGAAAGTTGTCTTTTTTATGCCCCTCTCTATAGGCCAT
AGGTGATAGTACAAAGTAATAAAATTTTGAAGTTTTACTTGTCAGTATATCTTAAATTTCTGATTTTACTTGCAATTTCTTCAGAAATGAAAATTTTTCCTCTTTCTTTGCTTGTATGCA
TTATTTTTGCTTACCAATAATCATAATACTTTTTCTGTTTTTTTTAATAATTCTGTGTGAAGCTCAGAAATAAGTAGACCTGAAAACAAGGGGCTTTCTGCAGCCTTGAATTTTATAGAG
GAAGCAAAAAAAGAGATAGATTCATATTCCAAAGGTGGACCTATTTCCTATGCAGATCTCATCCAGTATGCAG
GTTGAACATTTCATCCCCGTTTTGAAACATAATACTTATTACCTATG
AAGCACAGACACATATAATTACACTAAATTATGTGATTTCCTCAAATTATTAGCGGTGTCGGCGTGTCAGTGTCTGTGTCCACGATTCATAGCTTATTAGCAGTATATGTTTCACATGCA
TATTCTAAATATCTGTTGATTATTGTGAGCATTTTCTACAATACATGTTTCACATACTTGTTCTAAATGTCTGTTGATTATTGTGACGATTTTTTGTTAAATCAATTTTGATTAAGAATT
TGCTAGAAGTTGTAGGGATATATTCAAATTCCATTGACTTTATTGTCTTCATTTTTGTAGCACAAAGTGCAACAAAGGCTCAATTTTTAGCTTCTGCAATTCGCAAATGCGGTGGAAATG
AGGAGAAAGGGAATTTACTATACACTGCATATGGATCAAATGGACAG
GTTTTCTTTTGAACTTAAGCTCTTATCCAAAATCTGGTTAATACTAGCTCTGTCTCTAATTATAAGCCCCGTT
TATATAAAAATCGCTAAATATAAACCTCATTTTAATTAGTAGAGTAGATAGATTAATTATTATTTTTCAAAATATATCCCTTATTTATACTACGAATTTGTCTTAGAAGATGAAAAGTCC
AAATTTAACACATCTTTACACAATAGGATATTTTAGTAACATCTATATACAAAATGAATACATTAAATGCTATCTAACATCTATATTTTAGTAACATCTATATACAAAATGAATTCTAGA
TCAATGTCAGTTTGATCTATTATGCTTTAGTTATTTTCAAACTTTAGTAAGTGTACATTGGTAAGATTTATCTTATTATCAGCACAATCTGCACCTCTTCAAGTGAAAAATGGATAAAGA
TGTGTTGTGTTGATTTATCAATAATTACACAGAATAATGTCCTACAAAAACTTTATGAAATGATCCATGGTTGGAAATGTTCACAAGATGTTGCTAAATAACCCTTCACTAACACGAATA
CACGATCATGGAACACATCCAATTTTCGTTTTGGATCAGTGGGGTTTGTTCGATAGGCAATTTGGTAGGACTGATACTGACGAGGCAGATCCAGAGGGGAGAATTCCACTTTGGGAGAAA
GCAAGTGTTCAGGAAATGAAAGATAAATTTTCTGCAGTAGGCTTTGGTCCTCGCCAG
GTACTTCCCATATTTTATCACTATTTTTGCTCATTCTTGTCGATCGCTGATGCGCAAAATATA
GTGTGTTTGTTGACACTATAGAGCGCCACAATAACGGCTATTTGACAACATTGTACTAAATAGCGGATCATGACACAATAGTGATTGTTCAAATTTTGCTATGCTATCACGCTATATAAC
AACCCTGATCTTTCTTATAGAAATTTTGAAAGGCATATATAAGATGCCACCTGTATATAGAAGAGAAATTGCAATCTTGGTATATATGCTACAAAGTTCAACTTAGACTGACATAAGCAT
TTTCCCCTCTCCAGTGTCGCTATAAAATGATTAAAGCTATTCCATCTAAGAAACTATTCCCTACATTCCATTTAATGTTTTTTAGCGAAATGGTCTTGTCCGAACTCAGTTATCATTTTA
CAATTTCAGTTGAACAAATTGTTATTGTTTTGCGATATACTGTTTTGTACAAACCTCAATTTTCTGCGATCCACGATTGACAACATTGAATGTTACTAATTATGTTCTGTCTATTTGGGT
AGCTGGCTGTGTTGTCTGCATTCATAGGTCCTGATCAGGATGCAACAGAAACCTTATTGGCATCTGATCCAGATGTTGCTCCATGGGTACAAAAATACCAACGGAGCCGCGAAACTGTCT
CTCGAACCGACTACGAG
GTAAGTTTAACTATGAATCCCTCTCTATGCAAGAGAAGCAAAGCAGTTACTGAAACTTTCGTTTGGTTAAAAAAATTCACTTGGTAATTCTCTTTGGTTTGTT
ATCTTTCTCAGGTTGATCTGATAACCACTTTCACAAAATTGAGTACCTTGGGACAAAAAATTAACTATGAGGCATATACATATCCTCGCAAGAAGATCGACATTACCAAACTCAAGTTGT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTCTCTTTCCTCTCAATCTCAACTCTTCCTTCTCTTCATCCACTTGGTGGTTCTCATTATCCAAAAACAACTTCAACCAGACACCAACCTCGTTCAGTGTCCATTTGTTGTGCA
AAAATCAAGACTGATGTTAGCGATGAAGAAGAACAGTTCTTCCATTGGAGGCGAAGAGACGTTCTTAAATGCATTGGGTTGACCATTGGTTTG
GAGTCGATATCAAGCTCTGGATCGCTC
CTTGGAACCGCTAATGCTGCTGATCTAATAGAACGCAGACAGCGCTCTGATTTTCAGT
CTCAAATTAAAGGGACGCTATATACAGCAATAAAGGCAAATCCTGATCTTACTCCATCCATT
CTAACACTGGCTCTAAATGATGCTTTGACTTATGATAAG
GCAACGAAAACGGGTGGCCCAAATGGTTCTATCCGGTTCAGCTCAGAAATAAGTAGACCTGAAAACAAGGGGCTTTCTGCA
GCCTTGAATTTTATAGAGGAAGCAAAAAAAGAGATAGATTCATATTCCAAAGGTGGACCTATTTCCTATGCAGATCTCATCCAGTATGCAG
CACAAAGTGCAACAAAGGCTCAATTTTTA
GCTTCTGCAATTCGCAAATGCGGTGGAAATGAGGAGAAAGGGAATTTACTATACACTGCATATGGATCAAATGGACAG
TGGGGTTTGTTCGATAGGCAATTTGGTAGGACTGATACTGAC
GAGGCAGATCCAGAGGGGAGAATTCCACTTTGGGAGAAAGCAAGTGTTCAGGAAATGAAAGATAAATTTTCTGCAGTAGGCTTTGGTCCTCGCCAG
CTGGCTGTGTTGTCTGCATTCATA
GGTCCTGATCAGGATGCAACAGAAACCTTATTGGCATCTGATCCAGATGTTGCTCCATGGGTACAAAAATACCAACGGAGCCGCGAAACTGTCTCTCGAACCGACTACGAG
GTTGATCTG
ATAACCACTTTCACAAAATTGAGTACCTTGGGACAAAAAATTAACTATGAGGCATATACATATCCTCGCAAGAAGATCGACATTACCAAACTCAAGTTGTAA

Retrieve as FASTA