Entry information : MtPrx98 (Medtr3g094670.1[4.0] / Medtr3g094670.1[3.5] / Medtr3g145040.1[3.0])
Entry ID 6448
Creation 2008-12-31 (Christophe Dunand)
Last sequence changes 2011-12-13 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtPrx98 (Medtr3g094670.1[4.0] / Medtr3g094670.1[3.5] / Medtr3g145040.1[3.0])
Name (synonym) MtPrx98 (Medtr3g094670.1[4.0] / Medtr3g094670.1[3.5] / Medtr3g145040.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx98
start..stop
S start..stop
MtPrx54 579 0 1..322 1..322
MtPrx84 570 0 1..322 1..322
GmPrx328 553 0 6..322 5..320
GmPrx158 547 0 6..322 5..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43193871..43194089 219 N° 2 43194307..43194498 192 N° 3 43194647..43194812 166 N° 4 43194947..43195338 392
join(43193871..43194089,43194307..43194498,43194647..43194812,43194947..43195338 )


exon

Literature and cross-references MtPrx98 (Medtr3g094670.1[4.0] / Medtr3g094670.1[3.5] / Medtr3g145040.1[3.0])
DNA ref. Phytozome 12:   chr3 (43193871..43195338)
Cluster/Prediction ref. Phytozome Gene 12:   31060456
Protein sequence: MtPrx98 (Medtr3g094670.1[4.0] / Medtr3g094670.1[3.5] / Medtr3g145040.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (296)
PWM (Da):   %s   33854.65 (31120.2) Transmb domain:   %s   i12-34o
PI (pH):   %s   7.93 (7.68) Peptide Signal:   %s   cut: 27 range:27-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSLNCSRLTMISLVLFVLIIGSANAQLSTSFYSSSCPKLSSTVQSTVQSAISNEARMGASILRLFFHDCFVNGCDGSILLDDTSNFTGEKNANPNRNSARGFDVIDNIKTAVENVCPGVVSCADILAIAAADSVAILGGPTWNVKLGRRDAKTASQSAANTAIPAPTSNLNTLTSMFSAVGLSSKDLVTLSGAHTIGQARCTTFRARIYNETNIDTSFASTRQSNCPNTSGSGDNNLAPLDLQTPTSFDNNYFKNLVQNKGLLHSDQQLFNGGSTNSIVSGYSTNPSSFSSDFATAMIKMGDISPLTGSNGEIRKNCRKPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCTTTAAATTGTTCTAGATTAACCATGATCAGTTTGGTTCTATTTGTCCTCATAATAGGGAGTGCCAATGCACAACTTTCTACAAGTTTTTACTCAAGTTCTTGTCCCAAACTC
TCTTCCACTGTTCAATCCACAGTGCAATCCGCCATATCAAACGAGGCCCGAATGGGTGCTTCCATCCTCCGATTGTTCTTTCACGATTGCTTTGTCAAT
GTAAGCCTTCTTATGTCTCAC
TAATTTCATTTATAACACCATATATTTTTTTTCAACACACTTTCTTTTATTGATGTTTAAAGCGACGACATTTTATCATTGTCTTCGAGAAGATTTAAACTTTATCCATTGTGATATAAG
ATCAAATTTTTATTACTTTAGGTGATACCTCATAAGCAAAGAGTTAATTATAATAATATATTGCATGCGATTATAGGGATGTGACGGGTCAATTCTACTAGATGACACATCAAACTTTAC
TGGAGAGAAAAACGCAAATCCGAATAGAAACTCTGCTCGTGGATTTGATGTCATTGACAACATTAAGACAGCCGTAGAGAATGTATGTCCTGGCGTTGTATCATGTGCTGATATCCTTGC
CATCGCTGCCGCGGACTCCGTTGCAATC
GTAAGTGTAGTCATATATCAATGAATTAATTACTCAAACAATCAAAATCTAATTAATACTTCAATTGCAAGTGTAATCATGCAAAAGTAAAT
TAAGTGAAAATTAATCAATATTTCAACTGTCGTGTTTCTTTTAATTTACATGATAGCTTGGTGGCCCAACCTGGAACGTAAAACTTGGAAGAAGAGACGCCAAGACGGCTAGTCAATCTG
CTGCTAACACCGCAATCCCGGCACCAACTTCAAACCTTAATACACTCACCTCAATGTTTAGTGCTGTTGGTCTTTCCAGCAAGGACTTGGTCACATTGTCAG
GTGCAATTGCATTGATTT
GGACGATAAGCCTATGTTTTTTTTTTACTTATATTTAGTTCAAATATATAATTTCACAATTGGGAAGAGCACATAATTTTCAAATAATTAATTTGGTGTCTTAATTAATTGATTAGGTGC
TCACACAATTGGACAAGCAAGGTGCACAACCTTTAGGGCACGAATCTACAATGAGACCAACATAGATACTTCATTTGCTAGTACAAGACAATCAAATTGCCCAAATACATCTGGGTCAGG
GGACAACAATTTGGCACCTCTTGATCTTCAGACTCCCACTTCATTTGACAACAACTACTTCAAGAACCTTGTTCAAAACAAGGGTCTTCTTCATTCAGACCAACAACTTTTTAACGGCGG
ATCCACCAACTCCATAGTGAGTGGCTACAGTACTAATCCAAGTTCTTTTTCCTCAGATTTCGCCACTGCTATGATAAAGATGGGTGATATTAGTCCTCTCACCGGATCAAATGGAGAGAT
CAGAAAGAATTGTAGAAAACCTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCTTTAAATTGTTCTAGATTAACCATGATCAGTTTGGTTCTATTTGTCCTCATAATAGGGAGTGCCAATGCACAACTTTCTACAAGTTTTTACTCAAGTTCTTGTCCCAAACTC
TCTTCCACTGTTCAATCCACAGTGCAATCCGCCATATCAAACGAGGCCCGAATGGGTGCTTCCATCCTCCGATTGTTCTTTCACGATTGCTTTGTCAAT
GGATGTGACGGGTCAATTCTA
CTAGATGACACATCAAACTTTACTGGAGAGAAAAACGCAAATCCGAATAGAAACTCTGCTCGTGGATTTGATGTCATTGACAACATTAAGACAGCCGTAGAGAATGTATGTCCTGGCGTT
GTATCATGTGCTGATATCCTTGCCATCGCTGCCGCGGACTCCGTTGCAATC
CTTGGTGGCCCAACCTGGAACGTAAAACTTGGAAGAAGAGACGCCAAGACGGCTAGTCAATCTGCTGCT
AACACCGCAATCCCGGCACCAACTTCAAACCTTAATACACTCACCTCAATGTTTAGTGCTGTTGGTCTTTCCAGCAAGGACTTGGTCACATTGTCAG
GTGCTCACACAATTGGACAAGCA
AGGTGCACAACCTTTAGGGCACGAATCTACAATGAGACCAACATAGATACTTCATTTGCTAGTACAAGACAATCAAATTGCCCAAATACATCTGGGTCAGGGGACAACAATTTGGCACCT
CTTGATCTTCAGACTCCCACTTCATTTGACAACAACTACTTCAAGAACCTTGTTCAAAACAAGGGTCTTCTTCATTCAGACCAACAACTTTTTAACGGCGGATCCACCAACTCCATAGTG
AGTGGCTACAGTACTAATCCAAGTTCTTTTTCCTCAGATTTCGCCACTGCTATGATAAAGATGGGTGATATTAGTCCTCTCACCGGATCAAATGGAGAGATCAGAAAGAATTGTAGAAAA
CCTAACTAA

Retrieve as FASTA