Entry information : MtRboh10 (Medtr2g043900.1 [4.0])
Entry ID 6454
Creation 2009-01-07 (Christophe Dunand)
Last sequence changes 2014-07-31 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtRboh10 (Medtr2g043900.1 [4.0])
Name (synonym) MtRboh10 (Medtr2g043900.1 [4.0])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtRboh10
start..stop
S start..stop
LjRboh04 1574 0 1..931 1..939
GmRboh09 1536 0 1..931 1..914
GmRboh18 1460 0 37..931 1..881
PtRboh09 1337 0 17..931 22..926
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19075673..19076285 613 N° 2 19074472..19074634 163 N° 3 19072818..19072866 49 N° 4 19072598..19072711 114
N° 5 19071505..19071927 423 N° 6 19070549..19070932 384 N° 7 19070360..19070455 96 N° 8 19070104..19070219 116
N° 9 19069859..19070029 171 N° 10 19069452..19069611 160 N° 11 19069178..19069366 189 N° 12 19068929..19069057 129
N° 13 19068764..19068842 79 N° 14 19068518..19068627 110  
complement(join(19068518..19068627,19068764..19068842,19068929..19069057,1906917 8..19069366,19069452..19069611,19069859..19070029,19070104..19070219,19070360..1 9070455,19070549..19070932,19071505..19071927,19072598..19072711,19072818..19072 866,19074472..19074634,19075673..19076285))


exon

Literature and cross-references MtRboh10 (Medtr2g043900.1 [4.0])
Literature VandenBosch,K., Endre,G., Hur,J., Moore,J., Beremand,P., Ellis,L., Town,C.D., Bowman,C.L., Craven,M.B., Hansen,T.S., Holt,I.E. and Fraser,C.M. ESTs from uninoculated seedling roots of Medicago truncatula.
DNA ref. Phytozome 11:   chr2 (19076285..19068518)
EST ref. GenBank:   BE203618 [Fragment]
Cluster/Prediction ref. Phytozome Gene 11:   31064275
Omic ref. Gene atlas:   Mtr.3555.1.S1_at
Protein sequence: MtRboh10 (Medtr2g043900.1 [4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   931
PWM (Da):   %s   106177.49 Transmb domain:   %s   o372-391i504-526o552-574i732-749o
PI (pH):   %s   8.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTLSFERCTTSTNEQDLPENFETSSPVTGKHAYGAMLPVFLNDLRSNHHKELVEITLELENDAVLLRNIASASSAPNASPSSSHAGDEDTLAGVGFGVPRSLSITSRIRKKFPWLRSMSIRTSTSSSESVIAPVDDPMMARNARRMRAELERTRSSAQRGLKGLRFISKSGEASEELWRKVEERFGFLAKDGLLDREEFGECIGMEDSKEFAVGIFDALARRKERKSVSKITKEELHHFWLQISNQNFDARLQIFFDMADSNEDGRITREEVQLIMLSASANNLSKLKEQAEGYAALIMEELDPENLGYIELWQLEMLLLEKDRYMTYSRQHSSASVNWSQNMTNLRPKSKIHKIRKTLQCLALEYWRRGWILLLWLVTIACLFTWKFYQYKNRTSFQVMSYCLPVAKGAAETLKFNMALILLPVCRNTLTWLRSTKVRKFVPFDDNINFHKMIAFSIVVGILVHAGNHISCDFPLLVNSSPEKFSLIASDFNNKKPTYKSLFISIEGVTGITMLTLMVISFTLATSQFRRNAVNLPSPFNRLTGFNAFWYSHHLLGIVYILLFIHGSFLNLTHKWYQKTTWMYISVPLLLYIAERTLRTRRSHHYAVKVLKVSVLPGNVFSLLMSKPNGFKYKSGQYIFLQCPKISPFEWHPFSITSAPGDDYLSVHIRTVGDWTQELKLRFTEDDELPPVNTSATFGELIKLDQLGPPKLLVDGPYGAPAQDYQNFDVLLLIGLGIGATPFISILKDLLSDTRPIDEQDSNTETTKSDESFNSFTSSNVTPGRNKRSQRITNAYFYWVTREPGSFEWFKGVMDEVAEMDHKGLIELHNYLTSVYEEGDARSTLITMIQALNHAKHGVDILSGTRVRTHFARPNWREVFTKLASKHPNSTVGVFYCGMPVLAKELKKLSLELSHKTTTRFDFHKEYF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 13 introns) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACTTTGTCTTTTGAGAGGTGCACCACCAGCACAAACGAGCAAGACTTGCCGGAAAATTTTGAAACATCATCACCGGTGACCGGAAAACATGCTTATGGCGCAATGTTGCCGGTT
TTTCTCAACGACCTTCGTAGCAACCACCATAAAGAGCTCGTTGAAATAACATTAGAACTCGAAAACGACGCTGTCCTTCTCCGTAATATCGCATCGGCATCTTCAGCTCCAAACGCATCA
CCATCTTCAAGTCATGCTGGAGATGAAGACACCTTAGCCGGAGTTGGCTTTGGTGTCCCGAGGAGTCTTTCAATCACGTCGAGGATAAGGAAGAAATTTCCATGGCTGAGGTCGATGTCT
ATAAGGACATCGACCTCGTCATCAGAGAGTGTCATTGCACCCGTGGATGATCCGATGATGGCGCGAAATGCACGAAGAATGAGAGCGGAACTTGAACGGACGAGATCAAGTGCTCAAAGA
GGTTTGAAAGGATTGAGATTTATTAGTAAGTCTGGTGAAGCAAGTGAGGAGTTATGGAGAAAAGTTGAAGAGAGGTTTGGTTTTCTTGCTAAGGATGGTTTACTCGATAGAGAAGAGTTC
GGTGAATGCATTG
GTAAGCTATTTTTGTTTTTTTCTTTTTGACTCATGATAAGTTATTTTGTTTGGAGGCAAGGATAAGATTGAAGATTAAATGAAGCATTAATTCCTCAACACAAAAAA
AGTAAATAAAGCATTTATGACACTCTTATTTTCTTAAAACTTGATATTATTCGTACGTAACTGTAAATATTAATTCATGTGCCCTAATAGATGGAAATCGTCTATAAAAATTTGTTGTTA
TTATGCTTGAACTCAAATTTTAACATGAGATTTTAATTAAATTAGAAAAGACTCATATTTTTTCATCTAAACACCTTTAGGTGCATTTATGGTATTGTGGTACATGAATATTTAACTTCA
CACTCACTTTAATTTCCTTAAAAAAATGTATATTACGTGTAAGAAACAAGAATTGGCTGTTTATTTAAGTTATGTAATTAAATTAAATCTTTCAAAAATAAAGTTATACTATAAATTACA
TTTGACCCAAAAAAAAAAAAGTTATATAAATTACTCAATTAAGCATCTTCTCATTATAGTCAGCATTCTGAATTTTTTTAAAATTTGTTTTTATTTTCAACAGCAAACACCTTAATTATC
AAAAGTTTTTAAAGTGGTATTCTTAAATAAAAAGGAATTTTTTATTTTTTATTTTTATAAAAAATGGAACACATGTATTCAAGATTTTAGTTTAATAATTACTTCCGAATGTTATATGAA
AAACTCTTGTGAGAATTTTTTTACAATTTAAATAAAAAGTAAGCTAGAATAATTTTCATCAAAATACCTCTAAATAATTATTTTACTTATTTTCAAATTAATAATAAATATTATTATAGG
AAGATTACTTTTTTTATATTTCCTAAAGGTTAAATTTGAATAACAATACAAATTATAAATAAAATCAATATCATTATATTGTTTTTAGCCATATTATTACAAGTTTTTGTTTCATCTAAT
TTCAGTGATTAATTAGTTAATGGGTTTCTATATTTAGAGAGATGGATGATGTAATATATTTTTGATAAATATTGGTAAATGAATTTTGAAGGGATGGAGGATTCGAAAGAATTTGCGGTA
GGTATATTTGATGCATTAGCTCGAAGGAAGGAAAGAAAAAGTGTGAGCAAGATAACAAAAGAAGAGTTGCATCACTTTTGGTTGCAAATTTCAAACCAAAACTTTGATGCTCGACTTCAA
ATTTTCTTTGACAT
GTAAGTAATCTGTCCCTTTCCATGATGTATCACGGTCTACTCTCTTAGAAAACAAGAGGATGTAGTAGGTAACATAAAAATAAAAACTAGAGAAAGTATTGAAACA
ATATTAATGAATACTCTATCTCACCTTATTATAAATAAGTAAATTAGTCATGTATCATGTATAAGATTGTTTTGTACCATTAGATAGATAATTCAAATAATATCACCTTTGATATAATGG
TAAGATTTATTGATCTAATCTTAAAAACAAATTTATGCATATGGTGTAAGACATTTCTCATTAGTGCATCAATTACATTTTTTAAATTAAGAAAATATTAAAATAATGCTTACTATCTCT
TATATATCTCTTAAGATTACTTTAAAAAATTCTGTGACACTTAACTTATGTTGATATCATCGTGGATATGTTAGAATCACGATGATTCACAGTTAGTGTTAACAGATTATGAATGCTATT
TTATATTTCTTTTTTTGGTCAAGGATATAATTTCATATTAAATAAAAAATAGTTTCCATAATATTTAAGTTATGGCACTCATATATTTAATTTGGAACTGAGATTCATTATATATATCTG
CAGGTGTTTGTTTCTTTATTTGAGGGTTTGACTTGTGCATCTTTATTTATTGATAAATATGACTTGTCTATGCACCATGTCATCGTTTGAATTCAGATATTATAAATTCTGTTTGCGTGT
AAAATTGTGCATGTCAACGTTACTTTTACCGAGACCTCTACGTTGCAATCAGAAAATTGACTTTTTTGTAAAAGTTATTTTATTTAGTCAATAGTATAATTGTTGATGTCATGTCAGTCA
GTGTCCTGCTGGTGAACCACTTTAAAACTAAATTTTACCTTATTACAAATCAGTCCTCGTATAAAATATTAAAGGAATTTCAGTGCAAAAAATGAGAATCTATGTTTAACTTTGATTTAA
TCAGGGACACAATTTCAATAAGTAAATATATAATGACACACCTTATAGACAAATGTGGAATACACCATATAATCTGACGTGACATGGATTAAATACACAAATTCTCAATGATTGACCATT
TAACTTCACCAAAAAAAATCATTCTCATAACTTCACCATAGAATTTTCCTGCTCTTGTATCTACACACATAGGTTTCCTTGGATAGTACTAAATTTTTAGTTTCAATGATTAATTACACT
ACTAAGTTAAATTGAACTAATTAGTTGTTTTCATTTGATATATAAATGTTGTTGCTATTATTATATTATAATTCTTGGTAAAACTCATAGATGAGAAAAAACTACAAGAGAAATAAATTG
ATGTCAAGAGAATTGTATATATGAAGGGATACAACAATGTTCTTATAGTCAATGAGAACAACTGTCGTCATGAACTTACCTCAGTTGATAGAGATAATGATGATATATGTAATGTTCGGA
GTTCAAACCCCGACGACAAAAAAAAAATCATTGAGAACCACTAACTAGTGTAATTAATCATTGTAACTAAATCTTACATCTAATAGAGAAAAAGAACTTAATTGTGAATCATTTATTAAA
TGTTAATTTTTTTTGAGAAAATTGATTAAATGTTAAATTAAAATCTCTACTTCTTTCAGGGCAGACAGTAATGAAGATGGAAGAATAACTAGGGAGGAAGTACAAGAGGTAAGATTTACT
TAATAAATTATATTTTTCTTGTTAAAATAATTATATTTTTCTTATCATACACTCTGTTTTTAATTTCAATATTAATATTAATTTTAATCAACAGCTTATAATGCTAAGTGCTTCTGCAAA
CAATCTATCAAAGCTAAAAGAACAAGCAGAAGGATATGCTGCATTAATAATGGAAGAATTGGATCCGGAAAACCTGGGTTATATTGAG
GTAACAATAGACAGCATAATAAAATCACGTTA
AAAATCTAATCATTTGTTTTTCTTATCCAATACTTTAAGAGATAGTTCATTAAATTAAAAATGTCCTTTGTCCCGAAAAGCATAACTCAGTTGGTAAGAATAATGCATTATTATATGTAG
AGGTTAGAGTTTGAACTTTGAACACGTCACTTAATTAACAAAACTCAAGATTATCAGAATTTCTTAGAGTGTGTTTGGATGAGATAATTGAGAAATTTTAAAGAATTTAGAATCCTAGGT
AATTTAAATGATTCAAGTAAAAAAATTTCATTGTCATATTTTTGGGAAACTTTTATAAATTGTAATTTTTTGGGCCAAATTTGAAAATTGAAATTAGGGGTCAACTTGCAAATTTCAAAA
ATTTTAAAGGGTCAAATTATAATTTTTGGAAAATTTGAGGGGTCAATTTACAATTTTTTGAAAATTTGTTGGGTTCAAAATGAAAATTTTGGAAAATTTACGGACCAAAATGTAATATAC
GGTATATACACTGTATATACGGTGCAGTATAGGATTCATACTTTTACTAGTGCGTTTGTATTCACTCTTTTACTATTGAGTTTGTATAATGTGTCTCCATTTTTTCATTAATCTTTCTTA
ATCCGTACATAATTTTTTTTTTCTCTCCATTTTTTCAGCTATGGCAGCTAGAAATGTTGTTATTAGAAAAAGATAGATACATGACATACAGTAGACAACACAGCAGTGCAAGTGTAAACT
GGAGTCAAAATATGACAAATTTGAGACCAAAAAGTAAGATCCACAAAATACGCAAGACACTTCAATGTCTTGCTTTAGAATATTGGAGGAGGGGTTGGATTTTGTTACTGTGGTTGGTTA
CCATTGCTTGTCTTTTTACCTGGAAATTTTACCAGTACAAAAACAGAACAAGTTTTCAAGTTATGAGTTATTGCTTACCAGTAGCCAAAGGTGCTGCAGAGACACTCAAGTTCAACATGG
CTCTTATTCTTTTGCCGGTTTGTCGAAATACATTGACATGGCTTCGTTCTACAAAAGTTCGGAAATTTGTTCCCTTTGATGACAATATTAACTTTCACAAG
GTAAGCGGTGAATCATAGC
CATATAAGATGATTTATATGGTTCATAATTTTGTTGGTATAAATCAGTTTTGTGAGTTTGAATACGATTCCAAGGATGTTACTGTTAGAATTTAGAGTTGAGCCTAACTCAACTCTGACA
AAATTGACTTGTTCGTATGTTAAGGTCTTATCTCACGTGGAACTCTTAATACACAACCATCACATGAACATATGGAGTATCATCCGAGTAGCCCGATAGTAGTAACATTATAACATGTGG
TCTAGCAAATCTTGAATATGCTCTAAGTAGTCCGCATCGTCGTAGCATTGAAAAAAATGTCCCAAAATTTGGAATTTTGTAAAACATAAGGTTTACATGTATATTAAAACAGGCTAGAAA
AAAAATTGAGCTTGTAAAACTTGAACAAAGCATACATTACTTCGATTTTACTATGTTGAATTACACATAAAAATCAAAGACAAGTGTATAATTCTCTCATTGCGAATGTGACCAAATTAT
TGTTAGCTATGTAAACTCTATTATGATCATGTCCTTATTTGATTTTGTCTCTACTATCTTTCTATTTCAACAGATGATTGCATTTTCCATAGTAGTGGGAATACTTGTTCATGCAGGAAA
TCACATCTCATGCGATTTCCCTCTACTCGTAAACTCGTCTCCAGAAAAGTTCTCACTGATAGCTTCTGATTTCAACAACAAAAAGCCCACATACAAATCACTTTTCATTAGCATTGAAGG
TGTAACAGGAATCACAATGCTTACTTTGATGGTTATATCGTTTACACTAGCAACTAGCCAATTTCGAAGAAATGCAGTAAATCTTCCTTCGCCTTTCAACAGATTAACAGGCTTTAATGC
ATTCTGGTACTCACATCATCTTCTTGGTATTGTCTACATTCTTCTGTTCATTCATGGATCGTTCTTGAATTTGACGCATAAATGGTACCAGAAAACG
GTAAGAACTTCGACCATAATATT
CGTCGGTATGAGAAAAGTGAATGATGAGTAAAGTATACTAACATTTTTTTCTTTTCACTTTTGGTTTTAGACATGGATGTATATCTCTGTTCCATTGCTGCTGTATATTGCAGAGCGTAC
TCTACGAACACGTAGATCTCACCATTATGCAGTAAAAGTTCTTAAG
GTAACAAAATCACATTGTCTACTTTTAATTAGAACTCGACTTTTGGGAAAGTTTATATCTACTTCGATGGTTCG
AAAGACTTGATTGTGACAAAAGGAGAATAACATTTTTCGATTTAATTTCGCTTACTTCAACATCAGGTTTCAGTGCTACCAGGAAATGTATTTAGCTTACTCATGTCAAAGCCAAATGGA
TTCAAGTACAAAAGTGGCCAATACATATTTTTACAATGCCCGAAAATCTCTCCCTTTGAATG
GTCAGTGTAATTCTCAATTGATCATTGATCTTACAAAACATGAGCACATGAAAATAAA
CATATTGATTTTTTAGGCATCCATTCTCGATTACGTCAGCACCAGGAGATGATTACCTAAGTGTTCACATTCGAACGGTGGGTGATTGGACACAAGAGCTTAAGCTACGTTTCACCGAAG
ATGACGAATTGCCTCCTGTTAACACTAGCGCTACATTCGGTGAACTAATAAAACTGGATCAACTAGG
GTAAGTTTAGGTCATATCAGAGTTTTAAAAAAGGTTTATAATCACAATTTAGG
CGTTTTGATCTAACTTTTTTATGTCTATGTGGCTGAAATTTAATCATCATTCAAGTCGCATCAAACACATTTGACAATGATTATTCGCAATATCAAATATTGCAACGTGACTACAATATA
AGACGTCGACTTATGTTTTTCAATGCTTGCTAGTTACACAGTTGTAAATCATTAAAAGAATTTTTTCATTACAGACCGCCAAAGCTACTCGTTGATGGCCCATATGGAGCGCCTGCACAA
GATTACCAGAATTTCGATGTACTGCTGCTCATAGGATTAGGAATTGGAGCAACTCCCTTCATTAGTATTCTAAAAGATCTTCTGAGTGACACGAGACCAATTGACGAACAAATG
GTATAA
TCCATGCTCTTGCTTGTTTTCGATAACGTTGATTCCTTGTTATCATCAGCTTTCAATTTTAACAAGGTCAAAAATGCAGGACTCAAACACTGAAACAACAAAATCAGACGAGAGCTTCAA
TAGTTTCACATCATCAAACGTAACGCCGGGAAGAAATAAAAGATCACAAAGGATTACAAATGCTTACTTCTATTGGGTCACCAGAGAACCTGGATCTTTTGAATGGTTTAAAGGAGTAAT
GGATGAAGTTGCAGAAATGGACCACAAA
GTAATATTTAATTTTTTATATGAATATTTAATCATATATATACCATAGAAGTTAATCTTAATTATGTCATACTAATAAATAATATTGCAATG
TGATATCTTATTCTAAACCACTATTTAGGGTCTAATAGAACTGCACAACTATCTCACAAGTGTATATGAAGAAGGTGATGCAAGATCAACCCTAATCACAATGATCCAAGCATTAAACCA
TGCTAAACATGGTGTTGACATTCTATCAGGCACTAGA
GTGAGATCTTAAATACTTTAACAACTATTATTAATTATTTCAATTCATGGTGTTAACATAACTAATTTATTCTTTTTCTATTG
CAGGTGAGAACACATTTTGCTAGGCCTAATTGGAGAGAAGTTTTCACAAAATTAGCTTCTAAACACCCTAATTCTACAGTAGGTAAATTACTTGATAAACCTGCATAATTACTTGCAAAC
TACAATTAAGAGGAGATTAAGGTTGCTAAACTCAATTTAATTTTGGTTTGATAATATTAGAAAGTTTTTAACAAGCACATTATGCATAATATCTGCAGGAGTGTTCTATTGCGGGATGCC
GGTGCTGGCGAAGGAGCTAAAAAAGCTATCACTTGAGCTTAGCCATAAGACGACGACACGCTTTGATTTTCATAAGGAGTATTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACTTTGTCTTTTGAGAGGTGCACCACCAGCACAAACGAGCAAGACTTGCCGGAAAATTTTGAAACATCATCACCGGTGACCGGAAAACATGCTTATGGCGCAATGTTGCCGGTT
TTTCTCAACGACCTTCGTAGCAACCACCATAAAGAGCTCGTTGAAATAACATTAGAACTCGAAAACGACGCTGTCCTTCTCCGTAATATCGCATCGGCATCTTCAGCTCCAAACGCATCA
CCATCTTCAAGTCATGCTGGAGATGAAGACACCTTAGCCGGAGTTGGCTTTGGTGTCCCGAGGAGTCTTTCAATCACGTCGAGGATAAGGAAGAAATTTCCATGGCTGAGGTCGATGTCT
ATAAGGACATCGACCTCGTCATCAGAGAGTGTCATTGCACCCGTGGATGATCCGATGATGGCGCGAAATGCACGAAGAATGAGAGCGGAACTTGAACGGACGAGATCAAGTGCTCAAAGA
GGTTTGAAAGGATTGAGATTTATTAGTAAGTCTGGTGAAGCAAGTGAGGAGTTATGGAGAAAAGTTGAAGAGAGGTTTGGTTTTCTTGCTAAGGATGGTTTACTCGATAGAGAAGAGTTC
GGTGAATGCATTG
GGATGGAGGATTCGAAAGAATTTGCGGTAGGTATATTTGATGCATTAGCTCGAAGGAAGGAAAGAAAAAGTGTGAGCAAGATAACAAAAGAAGAGTTGCATCACTTT
TGGTTGCAAATTTCAAACCAAAACTTTGATGCTCGACTTCAAATTTTCTTTGACAT
GGCAGACAGTAATGAAGATGGAAGAATAACTAGGGAGGAAGTACAAGAGCTTATAATGCTAAGT
GCTTCTGCAAACAATCTATCAAAGCTAAAAGAACAAGCAGAAGGATATGCTGCATTAATAATGGAAGAATTGGATCCGGAAAACCTGGGTTATATTGAG
CTATGGCAGCTAGAAATGTTG
TTATTAGAAAAAGATAGATACATGACATACAGTAGACAACACAGCAGTGCAAGTGTAAACTGGAGTCAAAATATGACAAATTTGAGACCAAAAAGTAAGATCCACAAAATACGCAAGACA
CTTCAATGTCTTGCTTTAGAATATTGGAGGAGGGGTTGGATTTTGTTACTGTGGTTGGTTACCATTGCTTGTCTTTTTACCTGGAAATTTTACCAGTACAAAAACAGAACAAGTTTTCAA
GTTATGAGTTATTGCTTACCAGTAGCCAAAGGTGCTGCAGAGACACTCAAGTTCAACATGGCTCTTATTCTTTTGCCGGTTTGTCGAAATACATTGACATGGCTTCGTTCTACAAAAGTT
CGGAAATTTGTTCCCTTTGATGACAATATTAACTTTCACAAG
ATGATTGCATTTTCCATAGTAGTGGGAATACTTGTTCATGCAGGAAATCACATCTCATGCGATTTCCCTCTACTCGTA
AACTCGTCTCCAGAAAAGTTCTCACTGATAGCTTCTGATTTCAACAACAAAAAGCCCACATACAAATCACTTTTCATTAGCATTGAAGGTGTAACAGGAATCACAATGCTTACTTTGATG
GTTATATCGTTTACACTAGCAACTAGCCAATTTCGAAGAAATGCAGTAAATCTTCCTTCGCCTTTCAACAGATTAACAGGCTTTAATGCATTCTGGTACTCACATCATCTTCTTGGTATT
GTCTACATTCTTCTGTTCATTCATGGATCGTTCTTGAATTTGACGCATAAATGGTACCAGAAAACG
ACATGGATGTATATCTCTGTTCCATTGCTGCTGTATATTGCAGAGCGTACTCTA
CGAACACGTAGATCTCACCATTATGCAGTAAAAGTTCTTAAG
GTTTCAGTGCTACCAGGAAATGTATTTAGCTTACTCATGTCAAAGCCAAATGGATTCAAGTACAAAAGTGGCCAATAC
ATATTTTTACAATGCCCGAAAATCTCTCCCTTTGAATG
GCATCCATTCTCGATTACGTCAGCACCAGGAGATGATTACCTAAGTGTTCACATTCGAACGGTGGGTGATTGGACACAAGAG
CTTAAGCTACGTTTCACCGAAGATGACGAATTGCCTCCTGTTAACACTAGCGCTACATTCGGTGAACTAATAAAACTGGATCAACTAGG
ACCGCCAAAGCTACTCGTTGATGGCCCATAT
GGAGCGCCTGCACAAGATTACCAGAATTTCGATGTACTGCTGCTCATAGGATTAGGAATTGGAGCAACTCCCTTCATTAGTATTCTAAAAGATCTTCTGAGTGACACGAGACCAATTGAC
GAACAAATG
GACTCAAACACTGAAACAACAAAATCAGACGAGAGCTTCAATAGTTTCACATCATCAAACGTAACGCCGGGAAGAAATAAAAGATCACAAAGGATTACAAATGCTTACTTC
TATTGGGTCACCAGAGAACCTGGATCTTTTGAATGGTTTAAAGGAGTAATGGATGAAGTTGCAGAAATGGACCACAAA
GGTCTAATAGAACTGCACAACTATCTCACAAGTGTATATGAA
GAAGGTGATGCAAGATCAACCCTAATCACAATGATCCAAGCATTAAACCATGCTAAACATGGTGTTGACATTCTATCAGGCACTAGA
GTGAGAACACATTTTGCTAGGCCTAATTGGAGA
GAAGTTTTCACAAAATTAGCTTCTAAACACCCTAATTCTACAGTAG
GAGTGTTCTATTGCGGGATGCCGGTGCTGGCGAAGGAGCTAAAAAAGCTATCACTTGAGCTTAGCCATAAGACG
ACGACACGCTTTGATTTTCATAAGGAGTATTTTTGA

Retrieve as FASTA