Entry information : MtPrx76 (Medtr4g074990.1 [4.0] / Medtr4g074990 [3.5])
Entry ID 6457
Creation 2009-01-07 (Christophe Dunand)
Last sequence changes 2013-12-31 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-04-06 (Catherine Mathe)
Peroxidase information: MtPrx76 (Medtr4g074990.1 [4.0] / Medtr4g074990 [3.5])
Name (synonym) MtPrx76 (Medtr4g074990.1 [4.0] / Medtr4g074990 [3.5])
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx76
start..stop
S start..stop
MtPrx110 617 0 1..320 1..321
MtPrx67 574 0 1..320 4..324
GmPrx53 561 0 1..320 1..323
GmPrx209 561 0 1..320 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28592677..28592883 207 N° 2 28592393..28592584 192 N° 3 28592139..28592304 166 N° 4 28591605..28592002 398
complement(join(28591605..28592002,28592139..28592304,28592393..28592584,2859267 7..28592883))


exon

Literature and cross-references MtPrx76 (Medtr4g074990.1 [4.0] / Medtr4g074990 [3.5])
Protein ref. UniProtKB:   G7JPH5 [Incorrect prediction]
DNA ref. Phytozome 11:   chr4 (28592883..28591604)
Cluster/Prediction ref. Phytozome Gene 11:   31109781
Protein sequence: MtPrx76 (Medtr4g074990.1 [4.0] / Medtr4g074990 [3.5])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (298)
PWM (Da):   %s   34414.22 (31968.0)  
PI (pH):   %s   7.26 (7.29) Peptide Signal:   %s   cut: 23 range:23-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYRMITSFVFTLIVLGTICDAQLSSTFYDSTCPNALSTIRTSIRTAVSKECRMAASVIRLHFHDCFVQGCDASILLDDSPTIESEKNALPNINSVRGFEIIDKAKSEVEKICPGVVSCADILAVAARDASFAVGGPSWTVKLGRRDSTTASKSLANTDLPLFTDDLTTLISHFNKKNLTPRDMVTLSGAHTIGQAQCFTFRGRIYNNASDIDAGFANTRQRGCPSSRTTSNDQKLAALDLVTPNSFDNNYFKNLIQKKGLLQSDQVLFSGGSTDSIVSEYSNNPTTFKSDFAAAMIKMGDIEPLTGSAGIIRSICSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST. Incorrect prediction from Phytozome (last exon is splitted in two due to a probable sequencing error : GTT"T"TTATT extra T) => confirmed with two GSS: CG943566.1 and CR486690.1.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATAGAATGATCACTAGTTTTGTTTTCACATTGATTGTTCTAGGCACAATATGTGATGCGCAGCTTTCTTCTACTTTCTACGACAGTACATGCCCTAATGCCTTAAGCACTATT
AGAACTTCGATTCGTACTGCTGTCTCTAAGGAGTGTCGCATGGCGGCATCTGTCATTCGCCTTCATTTTCATGACTGTTTTGTCCAA
GTAATTACTATATTTATATTTATTAATCCTATA
ATATATACATATAATTGCACATTAGTTAATTTACTTACAAAATCTTACTTGATTGGCAGGGATGTGATGCATCAATTTTGTTGGATGACAGTCCTACAATCGAGAGCGAAAAGAATGCAC
TTCCTAATATTAACTCAGTAAGAGGATTTGAAATCATTGATAAAGCAAAATCTGAGGTTGAGAAAATTTGTCCCGGAGTTGTGTCTTGCGCGGACATACTAGCTGTGGCAGCACGTGATG
CATCATTTGCT
GTAAGTTTATAAGCTTCTTAAAATTTGCTTGTATAGTAGTAATATACAAAACTAAAATGTAACTAACAGTGACATTTATGTGATGCAGGTGGGTGGTCCATCATGGACG
GTAAAACTTGGACGGAGAGACTCTACCACAGCAAGCAAAAGTTTGGCCAATACTGACCTTCCGTTATTTACGGACGATCTTACAACTCTTATATCTCATTTTAATAAAAAAAATCTCACC
CCCAGAGACATGGTTACTCTATCTG
GTAAAATTTCATTACAAGTTCATTTATTTCAAACATGAATACTTTATATTTGTTTGTATGACTAATTTGTAATTAGTTAATGCGTAAACCTTTGC
CTGTATGAAAATTAATATTGGTCAATTTTATTTTAAATTAGGTGCGCACACAATCGGACAAGCTCAATGCTTCACATTTCGTGGCAGGATATACAACAATGCTAGTGACATTGATGCTGG
ATTTGCTAACACTCGTCAACGTGGTTGTCCGTCTTCCCGTACCACATCAAACGATCAAAAGTTGGCAGCCCTAGACTTGGTCACACCAAATTCATTTGACAACAACTACTTTAAAAATTT
AATTCAGAAGAAGGGTCTTCTTCAATCAGATCAAGTTTTATTCAGTGGAGGATCTACAGATTCTATCGTTTCTGAATACAGCAACAATCCTACAACTTTTAAGTCTGACTTTGCAGCTGC
TATGATAAAGATGGGAGATATTGAACCCTTGACTGGGTCGGCTGGTATCATAAGAAGCATCTGCAGTGCTGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATAGAATGATCACTAGTTTTGTTTTCACATTGATTGTTCTAGGCACAATATGTGATGCGCAGCTTTCTTCTACTTTCTACGACAGTACATGCCCTAATGCCTTAAGCACTATT
AGAACTTCGATTCGTACTGCTGTCTCTAAGGAGTGTCGCATGGCGGCATCTGTCATTCGCCTTCATTTTCATGACTGTTTTGTCCAA
GGATGTGATGCATCAATTTTGTTGGATGACAGT
CCTACAATCGAGAGCGAAAAGAATGCACTTCCTAATATTAACTCAGTAAGAGGATTTGAAATCATTGATAAAGCAAAATCTGAGGTTGAGAAAATTTGTCCCGGAGTTGTGTCTTGCGCG
GACATACTAGCTGTGGCAGCACGTGATGCATCATTTGCT
GTGGGTGGTCCATCATGGACGGTAAAACTTGGACGGAGAGACTCTACCACAGCAAGCAAAAGTTTGGCCAATACTGACCTT
CCGTTATTTACGGACGATCTTACAACTCTTATATCTCATTTTAATAAAAAAAATCTCACCCCCAGAGACATGGTTACTCTATCTG
GTGCGCACACAATCGGACAAGCTCAATGCTTCACA
TTTCGTGGCAGGATATACAACAATGCTAGTGACATTGATGCTGGATTTGCTAACACTCGTCAACGTGGTTGTCCGTCTTCCCGTACCACATCAAACGATCAAAAGTTGGCAGCCCTAGAC
TTGGTCACACCAAATTCATTTGACAACAACTACTTTAAAAATTTAATTCAGAAGAAGGGTCTTCTTCAATCAGATCAAGTTTTATTCAGTGGAGGATCTACAGATTCTATCGTTTCTGAA
TACAGCAACAATCCTACAACTTTTAAGTCTGACTTTGCAGCTGCTATGATAAAGATGGGAGATATTGAACCCTTGACTGGGTCGGCTGGTATCATAAGAAGCATCTGCAGTGCTGTCAAC
TAA

Retrieve as FASTA