Entry information : ZmPrx115 (AC197758.3_FG004 / Peroxidase 52)
Entry ID 6460
Creation 2009-01-09 (Christophe Dunand)
Last sequence changes 2009-01-09 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx115 (AC197758.3_FG004 / Peroxidase 52)
Name (synonym) ZmPrx115 (AC197758.3_FG004 / Peroxidase 52)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx115
start..stop
S start..stop
SbPrx83 595 0 28..360 1..331
SiPrx111 581 0 55..360 27..331
SiPrx54 573 0 36..360 2..321
ZmPrx64 572 0 59..358 18..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 183941695..183942024 330 N° 2 183942146..183942337 192 N° 3 183942409..183942574 166 N° 4 183943709..183944103 395
join(183941695..183942024,183942146..183942337,183942409..183942574,183943709..1 83944103)


exon

Literature and cross-references ZmPrx115 (AC197758.3_FG004 / Peroxidase 52)
Literature Wilson,R.K., Ko,A., Marchetto,P. and Ochoa,K. The sequence of Zea mays bac clone ZMMBBb-584M17. Unpublished.
Protein ref. UniProtKB:   B6U6W0
DNA ref. GenBank:   AC197758.3 (97266..99684)
mRNA ref. GenBank:   EU972975
EST ref. GenBank:   BM737349   BQ163439
Protein sequence: ZmPrx115 (AC197758.3_FG004 / Peroxidase 52)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360
PWM (Da):   %s   37452.7  
PI (pH):   %s   8.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLAHQLAHLILQGRRKHTAAGAALISTMAPAAPASATKCSSGIVISVLLPLALLMAAAGTSSAQLSTGFYSSSCPGVYDAVKSVVQSAVASEQRMGASIVRLFFHDCFVQGCDASLLLDDTPSFQGEKMANPNNGSVRGFEVIDAVKSAVEKVCPGVVSCADILAIAARDSVVILGGPTWDVKVGRRDSTTASFSGANNNIPPPTSGLANLTSLFAAQGLSQKDMVALSGAHTIGQARCTNFRAHVYNDTNIDGSFARTRQSGCPRSSGSSGDNNLAPLDLQTPTVFENNYYKNLVCKKGLLHSDQELFNGGATDALVQSYASGQSEFFSDFVTGMVKMGDITPLTGSGGQIRKNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns) and 2 ESTs. Incorrect prediction from Phytozome (short PS is missing). (BM737349, BQ163439 both compiled in Zm.84700).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGCTCACCAGCTAGCCCATCTCATTCTACAGGGAAGACGAAAACACACTGCAGCTGGAGCAGCACTGATATCGACCATGGCTCCAGCAGCACCTGCATCTGCGACAAAATGCAGC
AGCGGCATCGTCATCTCTGTGCTCTTGCCCCTCGCGCTGCTAATGGCGGCCGCCGGCACCTCGTCGGCGCAGCTGTCCACGGGCTTCTACTCTTCCTCGTGTCCCGGCGTGTACGACGCC
GTCAAGTCGGTGGTGCAGTCCGCCGTCGCCAGCGAGCAGCGCATGGGCGCCTCCATCGTCCGCCTCTTCTTCCACGACTGCTTCGTCCAG
GTACGTTATTACGTGTATGGTGGTGTGGAT
CGATCGACCATGTAGGTATGCACGCATGTTGTTGTGCTGCTTGATCTGTGACTGTGATCCGCGTGCATGTAATGTATGTATGTATATATAGGGCTGCGACGCGTCGCTGCTGCTGGACGA
CACGCCTAGCTTCCAGGGAGAGAAGATGGCCAACCCTAACAACGGCTCCGTGAGGGGATTCGAGGTCATCGACGCCGTCAAGTCCGCCGTCGAGAAGGTGTGCCCCGGCGTCGTCTCCTG
CGCCGACATCCTCGCCATCGCCGCCAGGGACAGCGTCGTCATC
GTGAGTACTGCTGAGGTTCTGTGTCAACAAGAGTGACGGATGAATGCTGATGCTGGTCTATCCACATGCAGCTGGGT
GGTCCGACCTGGGACGTGAAGGTCGGGCGGCGGGACTCCACGACGGCGAGCTTCAGCGGCGCCAACAACAACATCCCGCCGCCGACGTCGGGCCTCGCCAACCTCACGTCGCTCTTCGCC
GCCCAAGGCCTCTCCCAAAAGGACATGGTCGCGCTCTCCG
GTGCGTACTATTATTCTCATATGCACGTTCTACAAATTAAAAAAACTACGTATTCTTTAGTTAATTTAATTTCTCATATA
TATATATATATATATATATATATATATATATCGTTATATTACAAGGAGGCAGGCATATATACAAGAATATAGCAACAGCTACCCTTTCCAGCTGAAAGATGGAGCTTAAATAATGTACCT
TTACCAAAGTGACCTTAAATTTATAAAGATGGAAGCCTAATAATAATTTGATAGCTCCGTTTTGACGACGTGGAAGAACAAATTTTACACGCACACTACACAAATTAAATGATTAGTGTT
TGCCCATGTGTGTTCTTCGTATCACTACTAGACAAATATGTTATAAATTGTCATCACATGAAAGTTGGGCCAAAACAGTTATATATGCGCGCTGTTAAAAAAGTTAAAAAAGATGACATT
ACCTCATATTGTCGGCAGGGATTTTCACTGGCGGTTTTATTACGTCATATTGTCGGCAGGGATTTCATCATATCGATTTTCACTGGCGGTTTTATTACGTCGACCGCCAGTGAAAATCGA
TTTTCACTGGCGGTCTTCAGTTACCCGCCTGTAAAAATGATGATTTTTACTGACCTCTAGCACTGACGGTTACGATAAACGCCACTAAAAATAGGTTTACGACCGTCAGTATAGATCTTC
TCTGTACTAGTGACAGTTATATGCGCGCTGTTAAAAAAGTTAAAAGAGATGACATTACCTCATATTGTCGGCAGGGATTTCTTGTCGAAAATTCTTTGCCCAAAAGCTTCAACTTTATTC
TAATTAATCCTGCCTCTAATAACAAGATAGCAACTTTACTGAACTTTCGACGGCTGCAGTGTCTCTTCCACCTAATATCTTAATTCGACGAAATACTAAAGCACATGCAGGTTAGGTACA
CACCATACATGTGTGGTTAGCTTAATTCATTCCAAGAATCAGATACCTTTATTTATATTCTCTCTTTTTTTTTACAAATTTATTTAGACAGCGAAAAACAAGACGACGCTTCAAAAAAGT
TCATGTGCTAATTTAATTAAGCGGCAAATAGTTTTTAGATCATGCATGTTTCTCTCTTTTGTTTGTGTAACAATATGCATGCCTCTTCTATCAGGAGCTCACACCATCGGCCAAGCACGC
TGCACCAACTTCAGAGCCCACGTGTACAACGACACCAACATCGACGGCAGCTTCGCAAGAACAAGGCAGTCAGGCTGCCCTAGATCCTCAGGCTCATCAGGCGACAACAACCTGGCGCCA
TTGGACCTTCAAACCCCGACCGTCTTCGAGAACAACTACTACAAGAACCTTGTCTGCAAGAAGGGGCTCCTGCACTCCGACCAGGAGCTCTTCAATGGCGGAGCCACCGACGCGCTGGTC
CAGTCCTACGCCAGTGGCCAGAGCGAGTTCTTCTCGGACTTTGTGACGGGCATGGTGAAGATGGGTGACATCACTCCGTTAACTGGCTCCGGTGGGCAGATTAGGAAGAACTGCAGAAGG
GTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGCTCACCAGCTAGCCCATCTCATTCTACAGGGAAGACGAAAACACACTGCAGCTGGAGCAGCACTGATATCGACCATGGCTCCAGCAGCACCTGCATCTGCGACAAAATGCAGC
AGCGGCATCGTCATCTCTGTGCTCTTGCCCCTCGCGCTGCTAATGGCGGCCGCCGGCACCTCGTCGGCGCAGCTGTCCACGGGCTTCTACTCTTCCTCGTGTCCCGGCGTGTACGACGCC
GTCAAGTCGGTGGTGCAGTCCGCCGTCGCCAGCGAGCAGCGCATGGGCGCCTCCATCGTCCGCCTCTTCTTCCACGACTGCTTCGTCCAG
GGCTGCGACGCGTCGCTGCTGCTGGACGAC
ACGCCTAGCTTCCAGGGAGAGAAGATGGCCAACCCTAACAACGGCTCCGTGAGGGGATTCGAGGTCATCGACGCCGTCAAGTCCGCCGTCGAGAAGGTGTGCCCCGGCGTCGTCTCCTGC
GCCGACATCCTCGCCATCGCCGCCAGGGACAGCGTCGTCATC
CTGGGTGGTCCGACCTGGGACGTGAAGGTCGGGCGGCGGGACTCCACGACGGCGAGCTTCAGCGGCGCCAACAACAAC
ATCCCGCCGCCGACGTCGGGCCTCGCCAACCTCACGTCGCTCTTCGCCGCCCAAGGCCTCTCCCAAAAGGACATGGTCGCGCTCTCCG
GAGCTCACACCATCGGCCAAGCACGCTGCACC
AACTTCAGAGCCCACGTGTACAACGACACCAACATCGACGGCAGCTTCGCAAGAACAAGGCAGTCAGGCTGCCCTAGATCCTCAGGCTCATCAGGCGACAACAACCTGGCGCCATTGGAC
CTTCAAACCCCGACCGTCTTCGAGAACAACTACTACAAGAACCTTGTCTGCAAGAAGGGGCTCCTGCACTCCGACCAGGAGCTCTTCAATGGCGGAGCCACCGACGCGCTGGTCCAGTCC
TACGCCAGTGGCCAGAGCGAGTTCTTCTCGGACTTTGTGACGGGCATGGTGAAGATGGGTGACATCACTCCGTTAACTGGCTCCGGTGGGCAGATTAGGAAGAACTGCAGAAGGGTCAAT
TAA

Retrieve as FASTA