Entry information : PinvPrxQ02
Entry ID 6499
Creation 2009-01-19 (Christophe Dunand)
Last sequence changes 2012-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: PinvPrxQ02
Name PinvPrxQ02
Class Atypical 2-Cysteine peroxiredoxin (type Q)    [Orthogroup: PrxQ001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvPrxQ02
start..stop
S start..stop
SbrePrxQ01 261 4e-90 1..205 1..203
SlutPrxQ01 258 2e-88 1..205 1..205
PcPrxQ 225 4e-75 4..205 5..237
PplPrxQ01 223 6e-75 3..161 2..156
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1282761..1282902 142 N° 2 1282971..1283021 51 N° 3 1283091..1283188 98 N° 4 1283239..1283357 119
N° 5 1283410..1283617 208  
join(1282761..1282902,1282971..1283021,1283091..1283188,1283239..1283357,1283410 ..1283617)


exon

Literature and cross-references PinvPrxQ02
Literature Stephen,S.A., Caillau,M., Wright,D.P., Johansson,T., Tunlid,A., Soderstrom,B., Read,D.J. and Scholes,J.D. Transcriptional programmes for nutrient acquisition by the ectomycorrhizal fungus Paxillus involutus.
DNA ref. JGI genome:   scaffold_8 (1282761..1283753)
EST ref. GenBank:   EW970411 [5' end]
Cluster/Prediction ref. JGI gene:   98076
Protein sequence: PinvPrxQ02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   205
PWM (Da):   %s   22424.21  
PI (pH):   %s   5.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPHPLTNKEAPSFSLPDANGQTFEFPPEEGGKRVEKPIALFFYPESGTYGCTREACQFRDALAEKEIFKRSDVLVIGVSSDPVEKQKAFVEKHKLYPVLSDTAHVAHKAYQVGKGMLGLTDARTTFVIDRKGIVKGVLSASMNFSAHVKFVTKELEKMQNPNAPEDTAHDFGGEQDEENPAHLSESDMAEREELGRVAKAVSA

Retrieve as FASTA  
Remarks Complete sequence from genomic and 2 ESTs (EW970958). The 3' end looks shorter!!!
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCTCACCCTCTCACAAATAAGGAGGCACCATCCTTCTCCCTCCCAGATGCGAATGGCCAAACGTTCGAGTTTCCGCCGGAGGAAGGGGGCAAGCGCGTGGAGAAACCAATAGCA
TTATTCTTCTACCCCGAGTCCG
GTGAATAGTACTTCACAGGCTGTCATAATTCATCTCATACTGATCTTGTACGTTTCTGAAATACATAGGTACGTACGGTTGCACCCGTGAGGCGTGCC
AGTTTCGTGATGCGCTGGCTG
GTGCGTATCGTTTCTTCAGACAGGGGCTCATGTGAACTTACTCACATCAACGCACCGACCACACATTAGAGAAAGAAATCTTCAAGCGCTCTGATGTTC
TCGTAATCGGCGTCAGCTCTGACCCTGTAGAGAAACAAAAGGCTTTCGTTGAAAAACACAAACTCGCC
GTGAGTCTCTCGGACGATTTCTGAGAGTAATGATTGATGTGTTCACACAGTA
TCCGGTTTTGAGTGACACAGCTCACGTCGCACACAAAGCATACCAGGTTGGCAAGGGTATGCTCGGGTTGACCGATGCTCGTACCACCTTCGTCATCGATCGGAAGGGTATCGTAAA
GTG
CGTGATAATTTTTGGGTTTCTCGGTGGTTCTGATCCTTGTGTCGCTTAGGGGTGTTTTGAGCGCCTCAATGAACTTCAGTGCCCATGTCAAGTTTGTCACCAAGGAGCTCGAGAAAATGC
AAAACCCCAATGCACCAGAAGATACGGCCCATGACTTCGGAGGCGAACAAGATGAGGAGAATCCAGCACATCTTTCCGAGTCGGACATGGCGGAAAGGGAAGAGTTGGGACGAGTCGCAA
AAGCGGTTAGTGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCTCACCCTCTCACAAATAAGGAGGCACCATCCTTCTCCCTCCCAGATGCGAATGGCCAAACGTTCGAGTTTCCGCCGGAGGAAGGGGGCAAGCGCGTGGAGAAACCAATAGCA
TTATTCTTCTACCCCGAGTCCG
GTACGTACGGTTGCACCCGTGAGGCGTGCCAGTTTCGTGATGCGCTGGCTGAGAAAGAAATCTTCAAGCGCTCTGATGTTCTCGTAATCGGCGTCAGC
TCTGACCCTGTAGAGAAACAAAAGGCTTTCGTTGAAAAACACAAACTCGCC
TATCCGGTTTTGAGTGACACAGCTCACGTCGCACACAAAGCATACCAGGTTGGCAAGGGTATGCTCGGG
TTGACCGATGCTCGTACCACCTTCGTCATCGATCGGAAGGGTATCGTAAA
GGGTGTTTTGAGCGCCTCAATGAACTTCAGTGCCCATGTCAAGTTTGTCACCAAGGAGCTCGAGAAAATG
CAAAACCCCAATGCACCAGAAGATACGGCCCATGACTTCGGAGGCGAACAAGATGAGGAGAATCCAGCACATCTTTCCGAGTCGGACATGGCGGAAAGGGAAGAGTTGGGACGAGTCGCA
AAAGCGGTTAGTGCCTGA

Retrieve as FASTA