Entry information : PinvLDS01
Entry ID 6513
Creation 2009-01-21 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: PinvLDS01
Name PinvLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvLDS01
start..stop
S start..stop
SlutLDS01 982 0 37..896 30..876
SbreLDS01 976 0 38..896 31..876
PplLDS01-1 855 0 36..988 37..963
JargLDS01 855 0 36..931 35..932
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 197210..197383 174 N° 2 197442..197501 60 N° 3 197558..197642 85 N° 4 197684..198237 554
N° 5 198289..198507 219 N° 6 198562..198726 165 N° 7 198788..198867 80 N° 8 198925..199093 169
N° 9 199142..199175 34 N° 10 199220..199263 44 N° 11 199309..199356 48 N° 12 199406..199544 139
N° 13 199597..199940 344 N° 14 199994..200161 168 N° 15 200212..200297 86 N° 16 200346..200466 121
N° 17 200527..200830 304 N° 18 200878..200891 14 N° 19 200937..200957 21 N° 20 201014..201072 59
N° 21 201127..201154 28 N° 22 201212..201284 73 N° 23 201337..201368 32 N° 24 201421..201432 12
join(197210..197383,197442..197501,197558..197642,197684..198237,198289..198507, 198562..198726,198788..198867,198925..199093,199142..199175,199220..199263,19930 9..199356,199406..199544,199597..199940,199994..200161,200212..200297,200346..20 0466,200527..200830,200878..200891,200937..200957,201014..201072,201127..201154, 201212..201284,201337..201368,201421..201432)


exon

Literature and cross-references PinvLDS01
Literature Stephen,S.A., Caillau,M., Wright,D.P., Johansson,T., Tunlid,A., Soderstrom,B., Read,D.J. and Scholes,J.D. Transcriptional programmes for nutrient acquisition by the ectomycorrhizal fungus Paxillus involutus.
DNA ref. JGI genome:   scaffold_38 (197210..201432)
Cluster/Prediction ref. JGI gene:   14490
Protein sequence: PinvLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1011
PWM (Da):   %s   112057.16  
PI (pH):   %s   6.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQQKEVLHRSGLVLQSALQPLFSRVQSSKTRSVACITRDIHDLEQIAQRGPPLTANDLPAFANAVRNLHSNINDREFLLEKVLVLMSRLPDDSTFAKRAQEYVVDLRVPTVYKDLHHPPTGFLSTFKPLLSTPAGAENASYAFRSADGSNYNVLSPSLGQAGQPYARSVPSTHIQTFSSLPDPGVVFDTLLCRPKDDFVPHPGGLSSLFFAFANLITHSIFNTNMYDWTINGTSSYLDLSIVYGHTVEQVESMRRKDGSGKIWNDTFADSRLLFMPPSVCALAVLFSRHHYIAEKILGLNERGSYASPPPDEKMTRLAQDDEIFHRARLVNTAFFMQIILTDYVGGILGLVRDGLTWRLNPLAPFRESEHGISPRGGGNAVSVEFNLLYHWHASISAEDEKRLNGLFGQVFEGTDPRTISIKEFREVIREKIVPSGDAQTWTFDGLRRGPGGSFGDQDLARILQDATEQRAGAFRARGCPAVMRVVEILAIEQGRKWGACLNEFRNFMGLKPYASFREWNPDPDILAAEKLYGHIDNLELHVGLQAEETKPPIPGAGLCPGYTISRAILADAVCLTRGDRFLTVDFTPYNLTSWGYQYCMVNTADGSYGGILNKLLFGLLPTHYPAGSVYAHFPFMTPDFIRPCLASRSRDMVPFYDWSRPDHTEKNAIPVSANGSADRQPDGLYKQRISKLTGGVDVDVGVRTCIIDETLSAITFTTMVKNLVTKSSALASSDTMIIDIVKDVVNQVPIYWAANFILGLPVTTVDSVWGGRSVAQWLGLFGDVTRYIYLNDDPVYDWTMHEAALEATNEIIHYLRNRLIRHSKGISLKGASDVLVASVMTSNVQNDKFIAKILSATKHCDIQTVAYSIFDETVPSALLFSATLSSVVEYYSDPCRKEELQKLIQLSTDATKDRMGDIMDFVDRALGGRLLGQVRDGPLPPCLVIGGQEIKMDRQKGLMSRELFSVAPQIIQTIFSLENIRFPQSGMVIDGGLPASKVVYDI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (23 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAACAGAAAGAGGTTCTTCATCGCAGCGGGTTGGTCCTACAAAGCGCTCTGCAGCCGCTATTCTCCCGAGTGCAGAGCAGTAAGACACGTTCAGTAGCGTGCATCACCAGGGACATA
CATGACCTCGAGCAAATTGCTCAGCGTGGCCCACCCCTCACTGCAAACGACTTG
GTAGGACCCACCTTTCATTCATGCGTATCTCTTGAACATTGCCCTCACACAAATGTAGCCGGCTTT
CGCTAATGCCGTTAGGAACCTTCATAGTAACATCAATGATAGAGAATTTCTT
GTAAGTTATCTGCGAATGCTGGATATTGTAAGAGCCGAACTAACATAATGACCTAGCTCGAGAAGGTT
TTGGTACTTATGTCCCGCCTCCCGGACGATTCAACGTTCGCGAAAAGGGCGCAAGAATATGTTGTTGATTTAC
GTAGGTCTTTGAGTCCAGCATCCCAGCTGATACTTACGCAGGTGTCC
CAACAGTCTACAAGGACCTCCACCATCCTCCTACTGGATTTCTCTCTACCTTCAAACCCCTCTTATCGACTCCTGCCGGCGCAGAGAACGCATCATACGCGTTCCGAAGTGCAGATGGAT
CCAACTATAATGTTTTGTCCCCATCTCTAGGACAAGCTGGCCAACCTTACGCACGATCAGTGCCTTCCACTCATATCCAGACGTTCTCATCTCTTCCTGATCCAGGAGTAGTGTTCGACA
CTCTTCTGTGCAGGCCCAAAGACGACTTTGTACCGCATCCCGGTGGCTTGTCGAGTTTGTTCTTTGCCTTTGCGAATCTGATCACCCACAGCATCTTCAACACGAACATGTACGACTGGA
CAATCAATGGTACGAGTAGCTATCTCGACCTGAGCATTGTCTACGGACACACTGTGGAGCAGGTTGAGAGCATGCGGAGAAAAGATGGGTCGGGGAAAATCTGGAATGACACATTCGCCG
ACAGTCGTCTCCTATTCATGCCTCCCTCGGTTTGCGCGCTTGCGGTGCTTTTCAGTCGCCATCATAAC
GTATGTCCATGATCTAATCTTTAGTACGCATGCGCGCTAACGCGATGATAGT
ATATCGCCGAGAAGATCCTAGGCCTTAACGAACGTGGCTCTTATGCCTCACCCCCGCCTGATGAGAAGATGACCCGGCTCGCTCAAGACGACGAGATTTTCCACCGAGCGCGGTTGGTCA
ACACGGCTTTCTTTATGCAGATCATCCTCACAGATTATGTGGGCGGCATCCTGGGACTTGTGAGGGACGGTTTGACGTGGCGCCTCAACCCACTCGCG
GTAAGCTATCATTCATTGCTGG
CAGGGATAATGATCATCAAATTGGTGTAACAGCCATTCCGCGAATCGGAACATGGGATATCTCCTCGGGGAGGCGGAAATGCTGTTTCCGTCGAGTTCAACTTGCTCTATCATTGGCACG
CTTCCATTTCTGCGGAAGATGAGAAGCGGTTAAATGGGCTGTTTGGACAAGTCTTCGAGGGTACAGACCCGAGAACG
GTACGGTCTTCTTAATTCACCTCAGCTATCCAGTGCTTGGTTA
TGATACACGTTCTCCCAGATATCCATCAAGGAATTCAGAGAAGTGATCCGAGAAAAGATTGTCCCATCCGGGGACGCCCAGACCTGGACATTCGATGGGTAAGTTATGGAGCATGTGGTC
TTCGATTTCGATTTCCTGATAAAGCATGGCACTAGATTGCGGCGAGGCCCCGGCGGTAGCTTCGGTGATCAAGACCTCGCTCGCATCTTGCAGGATGCAACCGAGCAAAGGGCTGGTGCT
TTTCGTGCCAGAGGTTGTCCCGCCGTGATGCGAGTGGTTGAGATCTTGGCCATAGAGCAAGGGAGGAAGTGGGGCGCTTGCACT
GTCGGTCACGTCCTCGAATTTGCAATGTGATTTACT
GATTATCCGTAGCTCAACGAGTTTCGCAACTTTATGGGCCTGAAGCGTACGTCAATTCTATATGTTTCTTCCCTGGCTGATGTGTTACAGCGTATGCGAGCTTCCGTGAATGGAACCCCG
ACCCCGACATCCAT
GTAAGGCTCATCGAACGCTCAGTAAATTTGTCTAATCCTCCGCAGTTGGCAGCAGAAAAGCTTTACGGGCACATCGATAATTTGGAACTTCACGTTGGTATATTGT
GCACTTTCTTAACTGTCGGTGCTCATATTGTTGTAGGTCGGATTGCAAGCTGAGGAGACCAAGCCCCCAATCCCCGGTGCTGGATTATGTCCAGGATATACAATCTCGCGCGCGATATTG
GCAGACGCAGTATGCCTAACTCGTGGAGATCGTTTCCTAACGGTCGATTTTACCC
GTCGGTGTCGTTCGCTTTTCTATTCTAACCGCCTTGACCAACACCTGCTCAGCCTATAATCTGAC
ATCCTGGGGATACCAGTACTGCATGGTTAACACCGCGGACGGCTCATACGGGGGAATACTCAACAAGTTATTATTTGGCCTCCTCCCGACCCATTATCCTGCTGGCTCAGTTTATGCCCA
CTTTCCATTTATGACACCTGACTTCATACGCCCTTGCCTCGCTTCCAGATCAAGAGACATGGTCCCCTTTTACGATTGGTCGAGGCCGGATCATACCGAAAAGAATGCAATCCCCGTTTC
CGCCAATGGCTCCGCGGACCGCCAGCCGGATGGCCTCTACAAACAACGCATCTCAAAGCTCACAGGAGGCGTTGACGTAGATGTTGGAAAG
GTCGGATCTTAAACCCGGAGCTACTTGTG
TGTAGGTGATTGACACTGCTTTAGGTGCGGACGTGCATCATAGACGAGACACTCTCTGCCATTACGTTCACAACTATGGTGAAGAACTTGGTGACGAAATCGTCCGCCTTGGCGAGTAGC
GATACCATGATCATCGACATAGTGAAAGACGTCGTCAACCAAGTGCCTATCTACTGGGCTGCAAACTTCATC
GTAAGTACAAGCACGCGTATTGAAACCGACGTTATTCACGTTTGAACC
AGCTTGGTCTGCCTGTCACGACGGTTGACAGTGTCTGGGGAGGACGCTCAGTGGCACAATGGCTTGGATTATTTGGTGACGTGACAAGGTAGGACAAATTGCCGACTCTTGTCTTGCCCC
GCTGATCATGTGTTAGGTACATCTATCTCAATGATGACCCGGTCTACGACTGGACTATGCACGAGGCGGCGCTTGAGGCTACAAATGAGATAATCCACTACCTCCGGAACCGTTTGATAA
GACACAGCAAAGGAGTC
GTGCGTCTCAACACACCCCGAACCAATGAACATGGATCAGTGCTAACTTCCCTTTGACAGATCTCACTGAAAGGCGCTTCAGATGTACTTGTGGCTTCAGTCA
TGACAAGCAATGTGCAAAACGACAAATTCATTGCCAAGATTTTGTCCGCCACGAAGCACTGTGATATCCAAACCGTTGCATATAGCATCTTCGATGAGACGGTGCCGTCCGCGTTGTTGT
TTTCTGCTACTCTCTCCTCTGTAGTCGAGTACTACTCTGACCCATGCCGGAAGGAAGAATTGCAAAAACTCATCCAGCTGAGCACGGACGCTACAAAGGACCGCATGGGCGATATCATGG
ACTTCGTTGATAGGGCACTAG
GTACGTCTGTTTCTGTGTCCAGCCGTAATCAGCTCATTGGAAAGTAGGTGGTAGACTCGATGTGAGTCGTGACATGTATAGTTATCAAGAGACTAACCC
TTCCCAGCTCGGCCAGGTTCGGGATGGTGTGAGTGTGCATCTCCCATAAAAAATAAAAACGATCATGCTGACAAGATCCTGTAGCCATTACCCCCGTGTCTTGTCATCGGAGGTCAGGAA
ATAAAAATGGATAGGCAAAAAGG
GTGAGAACTCTCTTTGAGACGCTTAGGTTACCGGATGACATGCGTGTTGTATAGCCTTATGTCTCGGGAGCTTTTCTCAAAGGTGACTTGATCCACA
CGTGCTCTGGCGATCTAGCGCTGAACAACCATGTGTTGCTAGGTCGCTCCCCAAATCATCCAGACAATCTTCAGCTTAGAGAATATTCGTTTCCCCCAATCGGGAATGGTGATTGGTGAG
TTGTACCAGTCAACACAGTGATCCTGAAAGGCCAACGTGGTTTCTAGACGGAGGGCTGCCCGCTTCGAAGGTTGTCAAGGTTCGGACAAACCACACGCTGGCCGCTCATCATTTATTGAT
TGATCTTCCAGTATGACATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAACAGAAAGAGGTTCTTCATCGCAGCGGGTTGGTCCTACAAAGCGCTCTGCAGCCGCTATTCTCCCGAGTGCAGAGCAGTAAGACACGTTCAGTAGCGTGCATCACCAGGGACATA
CATGACCTCGAGCAAATTGCTCAGCGTGGCCCACCCCTCACTGCAAACGACTTG
CCGGCTTTCGCTAATGCCGTTAGGAACCTTCATAGTAACATCAATGATAGAGAATTTCTTCTCGAG
AAGGTTTTGGTACTTATGTCCCGCCTCCCGGACGATTCAACGTTCGCGAAAAGGGCGCAAGAATATGTTGTTGATTTAC
GTGTCCCAACAGTCTACAAGGACCTCCACCATCCTCCTACT
GGATTTCTCTCTACCTTCAAACCCCTCTTATCGACTCCTGCCGGCGCAGAGAACGCATCATACGCGTTCCGAAGTGCAGATGGATCCAACTATAATGTTTTGTCCCCATCTCTAGGACAA
GCTGGCCAACCTTACGCACGATCAGTGCCTTCCACTCATATCCAGACGTTCTCATCTCTTCCTGATCCAGGAGTAGTGTTCGACACTCTTCTGTGCAGGCCCAAAGACGACTTTGTACCG
CATCCCGGTGGCTTGTCGAGTTTGTTCTTTGCCTTTGCGAATCTGATCACCCACAGCATCTTCAACACGAACATGTACGACTGGACAATCAATGGTACGAGTAGCTATCTCGACCTGAGC
ATTGTCTACGGACACACTGTGGAGCAGGTTGAGAGCATGCGGAGAAAAGATGGGTCGGGGAAAATCTGGAATGACACATTCGCCGACAGTCGTCTCCTATTCATGCCTCCCTCGGTTTGC
GCGCTTGCGGTGCTTTTCAGTCGCCATCATAAC
TATATCGCCGAGAAGATCCTAGGCCTTAACGAACGTGGCTCTTATGCCTCACCCCCGCCTGATGAGAAGATGACCCGGCTCGCTCAA
GACGACGAGATTTTCCACCGAGCGCGGTTGGTCAACACGGCTTTCTTTATGCAGATCATCCTCACAGATTATGTGGGCGGCATCCTGGGACTTGTGAGGGACGGTTTGACGTGGCGCCTC
AACCCACTCGCG
CCATTCCGCGAATCGGAACATGGGATATCTCCTCGGGGAGGCGGAAATGCTGTTTCCGTCGAGTTCAACTTGCTCTATCATTGGCACGCTTCCATTTCTGCGGAAGAT
GAGAAGCGGTTAAATGGGCTGTTTGGACAAGTCTTCGAGGGTACAGACCCGAGAACG
ATATCCATCAAGGAATTCAGAGAAGTGATCCGAGAAAAGATTGTCCCATCCGGGGACGCCCAG
ACCTGGACATTCGATGG
ATTGCGGCGAGGCCCCGGCGGTAGCTTCGGTGATCAAGACCTCGCTCGCATCTTGCAGGATGCAACCGAGCAAAGGGCTGGTGCTTTTCGTGCCAGAGGTTGT
CCCGCCGTGATGCGAGTGGTTGAGATCTTGGCCATAGAGCAAGGGAGGAAGTGGGGCGCTTGCACT
CTCAACGAGTTTCGCAACTTTATGGGCCTGAAGCCGTATGCGAGCTTCCGTGAA
TGGAACCCCGACCCCGACATCCAT
TTGGCAGCAGAAAAGCTTTACGGGCACATCGATAATTTGGAACTTCACGTCGGATTGCAAGCTGAGGAGACCAAGCCCCCAATCCCCGGTGCTGGA
TTATGTCCAGGATATACAATCTCGCGCGCGATATTGGCAGACGCAGTATGCCTAACTCGTGGAGATCGTTTCCTAACGGTCGATTTTACCC
CCTATAATCTGACATCCTGGGGATACCAG
TACTGCATGGTTAACACCGCGGACGGCTCATACGGGGGAATACTCAACAAGTTATTATTTGGCCTCCTCCCGACCCATTATCCTGCTGGCTCAGTTTATGCCCACTTTCCATTTATGACA
CCTGACTTCATACGCCCTTGCCTCGCTTCCAGATCAAGAGACATGGTCCCCTTTTACGATTGGTCGAGGCCGGATCATACCGAAAAGAATGCAATCCCCGTTTCCGCCAATGGCTCCGCG
GACCGCCAGCCGGATGGCCTCTACAAACAACGCATCTCAAAGCTCACAGGAGGCGTTGACGTAGATGTTGGAAAG
GTGCGGACGTGCATCATAGACGAGACACTCTCTGCCATTACGTTC
ACAACTATGGTGAAGAACTTGGTGACGAAATCGTCCGCCTTGGCGAGTAGCGATACCATGATCATCGACATAGTGAAAGACGTCGTCAACCAAGTGCCTATCTACTGGGCTGCAAACTTC
ATC
CTTGGTCTGCCTGTCACGACGGTTGACAGTGTCTGGGGAGGACGCTCAGTGGCACAATGGCTTGGATTATTTGGTGACGTGACAAGGTACATCTATCTCAATGATGACCCGGTCTAC
GACTGGACTATGCACGAGGCGGCGCTTGAGGCTACAAATGAGATAATCCACTACCTCCGGAACCGTTTGATAAGACACAGCAAAGGAGTC
ATCTCACTGAAAGGCGCTTCAGATGTACTT
GTGGCTTCAGTCATGACAAGCAATGTGCAAAACGACAAATTCATTGCCAAGATTTTGTCCGCCACGAAGCACTGTGATATCCAAACCGTTGCATATAGCATCTTCGATGAGACGGTGCCG
TCCGCGTTGTTGTTTTCTGCTACTCTCTCCTCTGTAGTCGAGTACTACTCTGACCCATGCCGGAAGGAAGAATTGCAAAAACTCATCCAGCTGAGCACGGACGCTACAAAGGACCGCATG
GGCGATATCATGGACTTCGTTGATAGGGCACTAG
GTGGTAGACTCGATCTCGGCCAGGTTCGGGATGGTCCATTACCCCCGTGTCTTGTCATCGGAGGTCAGGAAATAAAAATGGATAGG
CAAAAAGG
CCTTATGTCTCGGGAGCTTTTCTCAAAGGTCGCTCCCCAAATCATCCAGACAATCTTCAGCTTAGAGAATATTCGTTTCCCCCAATCGGGAATGGTGATTGACGGAGGGCTG
CCCGCTTCGAAGGTTGTCAAG
TATGACATCTAA

Retrieve as FASTA