Entry information : LbiHalPrx02
Entry ID 6515
Creation 2009-01-23 (Christophe Dunand)
Last sequence changes 2009-01-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: LbiHalPrx02
Name LbiHalPrx02
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue types Mycelium
Sporocarp (fruiting body)
Inducer Infected host
Repressor N/D
Best BLASTp hits
Perox score E-value LbiHalPrx02
start..stop
S start..stop
LbiHalPrx01 509 0 1..293 1..291
CcinHalPrx01 351 3e-122 18..286 14..281
PinvHalPrx02 342 5e-119 1..285 1..283
CcinHalPrx02 338 1e-117 18..275 15..271
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2150542..2150764 223 N° 2 2150818..2151027 210 N° 3 2151089..2151302 214 N° 4 2151361..2151598 238
join(2150542..2150764,2150818..2151027,2151089..2151302,2151361..2151598)


exon

Literature and cross-references LbiHalPrx02
DNA ref. JGI genome:   LG_1 (2150542..2151598)
EST ref. GenBank:   EX780298.1 [5' end]   EX780297.1 [3' end]
Protein sequence: LbiHalPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   294
PWM (Da):   %s   32203.22  
PI (pH):   %s   6.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLVTPIARAILDAGVFSWDLGLTLINLVTPRRKVDHVTPAGHPGEGGKWPEYIAPKEGDSRCSCPGLNAMANHGILPRDGKNISFPELYSTVRGTYNFSPSFCFYVANFAARMLNKSYGKDRIDLADIDLHSDKGIEHDASLTREDIHFVKDQGKPHLPFVRELLDAASGKDTEGNMLFTAADVSRVLSKRRAESRANNPEFHMNLSHRTFSSSNSSTILTIFGSRVSDLESIFIEERLPEGWESRIREPFGLTIASLQPTVLKVAFGIDERPYAAEASSTAAAESGEPNPAT

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 10 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTCGTAACCCCCATAGCCAGAGCGATTCTAGACGCTGGGGTTTTCTCATGGGACCTCGGATTGACGTTGATCAACCTCGTGACGCCGCGCAGGAAGGTGGACCATGTAACCCCT
GCGGGCCATCCTGGAGAAGGTGGAAAATGGCCTGAATATATCGCACCGAAGGAGGGAGATAGTCGGTGCTCGTGCCCAGGGTTGAACGCTATGGCGAATCATG
GTATGTTTATCGGTTGG
TCGCGACGTAAGTCAACCTTACTGAATTATTGACAGGTATCTTACCACGCGATGGGAAGAACATCTCGTTCCCGGAGTTGTATAGCACAGTCAGGGGAACCTATAACTTTTCACCCTCTT
TCTGCTTCTACGTCGCAAACTTTGCTGCTAGGATGTTGAACAAGAGTTACGGGAAGGATAGGATCGACTTGGCTGATATCGATTTGCACAGTGACAAGGGCATTGAACACGACGCGTCTC
TCACTC
GTGAGTTCTTTTTTTTGTTCCAATGTCGTAATAAAGGTTACCGACCGCATAAATTGAACAGGCGAAGACATTCATTTCGTCAAAGACCAAGGGAAGCCCCACCTTCCTTTCGTA
AGGGAACTTCTCGACGCTGCATCGGGAAAGGACACGGAAGGAAACATGCTCTTCACCGCAGCCGACGTTTCTCGTGTTTTATCCAAGCGTCGTGCAGAGTCTCGTGCCAATAACCCCGAG
TTCCACATGAACCTATCCCACAGGACGTTTAGCAGTTCCAA
GTGCGTTTTTTCATCCTCCCTCCCCTCCTCTATCTATAATCTCAACCTTCTTTTGAAGCTCTTCAACTATCTTGACGAT
ATTCGGCAGTCGGGTCTCTGATCTCGAGTCCATCTTTATCGAAGAGCGTCTTCCTGAAGGGTGGGAGTCAAGGATCAGGGAGCCCTTCGGCTTGACGATAGCGTCTTTGCAACCAACTGT
CCTCAAAGTGGCGTTTGGGATTGACGAGCGCCCATACGCCGCGGAGGCTAGTTCGACTGCAGCCGCTGAAAGTGGGGAACCGAATCCAGCAACATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTCGTAACCCCCATAGCCAGAGCGATTCTAGACGCTGGGGTTTTCTCATGGGACCTCGGATTGACGTTGATCAACCTCGTGACGCCGCGCAGGAAGGTGGACCATGTAACCCCT
GCGGGCCATCCTGGAGAAGGTGGAAAATGGCCTGAATATATCGCACCGAAGGAGGGAGATAGTCGGTGCTCGTGCCCAGGGTTGAACGCTATGGCGAATCATG
GTATCTTACCACGCGAT
GGGAAGAACATCTCGTTCCCGGAGTTGTATAGCACAGTCAGGGGAACCTATAACTTTTCACCCTCTTTCTGCTTCTACGTCGCAAACTTTGCTGCTAGGATGTTGAACAAGAGTTACGGG
AAGGATAGGATCGACTTGGCTGATATCGATTTGCACAGTGACAAGGGCATTGAACACGACGCGTCTCTCACTC
GCGAAGACATTCATTTCGTCAAAGACCAAGGGAAGCCCCACCTTCCT
TTCGTAAGGGAACTTCTCGACGCTGCATCGGGAAAGGACACGGAAGGAAACATGCTCTTCACCGCAGCCGACGTTTCTCGTGTTTTATCCAAGCGTCGTGCAGAGTCTCGTGCCAATAAC
CCCGAGTTCCACATGAACCTATCCCACAGGACGTTTAGCAGTTCCAA
CTCTTCAACTATCTTGACGATATTCGGCAGTCGGGTCTCTGATCTCGAGTCCATCTTTATCGAAGAGCGTCTT
CCTGAAGGGTGGGAGTCAAGGATCAGGGAGCCCTTCGGCTTGACGATAGCGTCTTTGCAACCAACTGTCCTCAAAGTGGCGTTTGGGATTGACGAGCGCCCATACGCCGCGGAGGCTAGT
TCGACTGCAGCCGCTGAAAGTGGGGAACCGAATCCAGCAACATAG

Retrieve as FASTA