Entry information : LbiHalPrx03
Entry ID 6516
Creation 2009-01-23 (Christophe Dunand)
Last sequence changes 2009-01-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: LbiHalPrx03
Name LbiHalPrx03
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue types Mycelium
Sporocarp (fruiting body)
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LbiHalPrx03
start..stop
S start..stop
SbreHalPrx04 147 1e-42 4..286 2..221
SlutHalPrx04 145 3e-42 4..284 2..219
PinvHalPrx04 136 6e-39 1..284 1..219
AbHalPrx02_bisporus 110 9e-29 12..280 31..251
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1108841..1108959 119 N° 2 1108025..1108774 750 N° 3 1107795..1107948 154  
complement(join(1107795..1107948,1108025..1108774,1108841..1108959))


exon

Literature and cross-references LbiHalPrx03
DNA ref. JGI genome:   LG_8 (1108959..1107795)
EST ref. GenBank:   EX801116.1 [5' end]
Protein sequence: LbiHalPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340
PWM (Da):   %s   37501.28 Transmb domain:   %s   i52-74o
PI (pH):   %s   8.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASTQTKGFPDNHHFIPPKPSQSRSPCPALNAMANHGYISREGTQVTFFKLIIALVKVYNISVPLAFLLAFVGFLTCGRLSFYSPADDSQDLPIHHSGPSTSASKLLFQDFAKLRRLRSFPPRLRWTLDLASLSQRGATKITHDASLVHPNTLPSTSPDPGLVSSFLGYAVDHVHPKRQLGLTLVDIAHLHASREASSPSPLSSFHEQIALGECGLAWLVLRPHCLNRKASEQEDVIPLCVLEQWFGEERLPEGWWDVGGSRPIKQFGLLEARRRAEDVGKFIHDASQWYFCNVSIVYSRVSAITCGIISMSIDAVRPRVSLTAGASYGLKFFRFSECL

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns) and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAGCACTCAAACGAAAGGATTCCCGGACAATCACCACTTCATCCCCCCGAAGCCCTCTCAAAGTCGTTCCCCATGTCCCGCTCTGAACGCAATGGCGAATCATGGGTATATG
TCAGTCCTACTCCTCGTATCGATCGTCCGTTCTTCTTTTGAGCTCATATATGCGCGGTAATCTAGCTCGCGAGAAGGAACGCAAGTCACATTCTTCAAGTTGATCATTGCTCTAGTGAAA
GTGTACAATATCTCTGTTCCGCTTGCCTTCCTGCTTGCCTTTGTGGGTTTCTTGACTTGTGGTCGGCTCTCGTTTTATTCTCCAGCGGACGATAGTCAAGATCTTCCCATTCATCACTCT
GGACCCTCAACATCCGCAAGTAAACTTCTGTTCCAGGATTTTGCCAAGCTCCGGCGTCTGCGTAGCTTTCCCCCGCGTCTCCGATGGACCCTGGACCTGGCGTCCCTCTCTCAGCGCGGT
GCAACAAAGATCACGCACGATGCTTCCCTAGTTCACCCAAATACTCTCCCGTCAACCTCCCCCGACCCCGGGCTTGTCTCTAGTTTCCTTGGCTATGCAGTCGACCACGTTCATCCCAAG
CGTCAACTCGGGCTTACACTAGTGGACATCGCACACTTGCACGCGTCTCGAGAGGCGTCTTCTCCGAGTCCTCTCAGCTCCTTTCACGAGCAGATCGCGTTGGGGGAGTGTGGCCTAGCT
TGGTTGGTTCTTCGTCCTCATTGTCTCAATCGCAAGGCAAGCGAGCAAGAGGACGTTATTCCGTTGTGCGTTCTTGAGCAATGGTTTGGTGAGGAGCGGCTTCCTGAAGGGTGGTGGGAT
GTCGGAGGTTCTCGGCCGATAAAACAATTTGGTTTGCTTGAGGCGAGGAGGAGGGCAGAAGATGTAGGGAAATTTATTCATGATGCTTCTCAGTG
GTACGTCTTTCTTCGTTCTTATTCA
ATTCATACGTTGATTTTGGATAGATTCAATTAACGCTTGCGAACCGGTTAGGTATTTCTGTAACGTAAGTATAGTTTACAGTCGTGTTAGCGCTATCACATGTGGGATCATTTCTATGTC
TATCGATGCTGTTCGTCCCCGCGTTTCTTTAACAGCTGGCGCTTCTTATGGTCTAAAATTCTTCCGCTTCTCCGAGTGCTTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAGCACTCAAACGAAAGGATTCCCGGACAATCACCACTTCATCCCCCCGAAGCCCTCTCAAAGTCGTTCCCCATGTCCCGCTCTGAACGCAATGGCGAATCATGGGTATATC
TCGCGAGAAGGAACGCAAGTCACATTCTTCAAGTTGATCATTGCTCTAGTGAAAGTGTACAATATCTCTGTTCCGCTTGCCTTCCTGCTTGCCTTTGTGGGTTTCTTGACTTGTGGTCGG
CTCTCGTTTTATTCTCCAGCGGACGATAGTCAAGATCTTCCCATTCATCACTCTGGACCCTCAACATCCGCAAGTAAACTTCTGTTCCAGGATTTTGCCAAGCTCCGGCGTCTGCGTAGC
TTTCCCCCGCGTCTCCGATGGACCCTGGACCTGGCGTCCCTCTCTCAGCGCGGTGCAACAAAGATCACGCACGATGCTTCCCTAGTTCACCCAAATACTCTCCCGTCAACCTCCCCCGAC
CCCGGGCTTGTCTCTAGTTTCCTTGGCTATGCAGTCGACCACGTTCATCCCAAGCGTCAACTCGGGCTTACACTAGTGGACATCGCACACTTGCACGCGTCTCGAGAGGCGTCTTCTCCG
AGTCCTCTCAGCTCCTTTCACGAGCAGATCGCGTTGGGGGAGTGTGGCCTAGCTTGGTTGGTTCTTCGTCCTCATTGTCTCAATCGCAAGGCAAGCGAGCAAGAGGACGTTATTCCGTTG
TGCGTTCTTGAGCAATGGTTTGGTGAGGAGCGGCTTCCTGAAGGGTGGTGGGATGTCGGAGGTTCTCGGCCGATAAAACAATTTGGTTTGCTTGAGGCGAGGAGGAGGGCAGAAGATGTA
GGGAAATTTATTCATGATGCTTCTCAGTG
GTATTTCTGTAACGTAAGTATAGTTTACAGTCGTGTTAGCGCTATCACATGTGGGATCATTTCTATGTCTATCGATGCTGTTCGTCCCCGC
GTTTCTTTAACAGCTGGCGCTTCTTATGGTCTAAAATTCTTCCGCTTCTCCGAGTGCTTATGA

Retrieve as FASTA