Entry information : CcinPrxQ
Entry ID 6524
Creation 2009-01-24 (Christophe Dunand)
Last sequence changes 2009-01-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinPrxQ
Name CcinPrxQ
Class Atypical 2-Cysteine peroxiredoxin (type Q)    [Orthogroup: PrxQ001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinPrxQ
start..stop
S start..stop
LbiPrxQ02 301 5e-105 1..229 1..226
PplPrxQ02 283 8e-98 1..230 1..228
AmusPrxQ 276 2e-94 2..227 3..247
AbPrxQ_bisporus 275 3e-94 17..226 22..243
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1712564..1712755 192 N° 2 1712255..1712435 181 N° 3 1712060..1712181 122 N° 4 1711815..1711969 155
N° 5 1711702..1711753 52  
complement(join(1711702..1711753,1711815..1711969,1712060..1712181,1712255..1712 435,1712564..1712755))


exon

Literature and cross-references CcinPrxQ
Literature Tsang,A., Storms,R. and Butler,G. Expressed sequence tags from Coprinus cinereus cDNA library.
DNA ref. JGI genome:   Chr_12 (1712755..1711705)
mRNA ref. GenBank:   XM_001835149
EST ref. GenBank:   DY850209.1
Cluster/Prediction ref. Genebank:   6011799
Protein sequence: CcinPrxQ
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   233
PWM (Da):   %s   24720.73  
PI (pH):   %s   8.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPARAKSSEGAASAEPPRRSSRIAAQPQPDPPAPKPQRKASSSKKRAAEEPAAEEKSAESSSKKAKSDSDEAGNGDEAASLQPIDIGDSLPSLVLKNEKGEDIQIADLAKEKGVVLFLVPRADTPGCTTQACGFRDIYPDFSSVNFDVYCLSADSPTAQTKWQTKELPYSLISDPKRSLIAALGASEGGKTKRSHFIFEKGGKLVEKRNPVKPGESPQLALEFIKGLESKAE

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGCCCGTGCCAAGTCGAGTGAAGGTGCTGCGTCGGCTGAGCCTCCGAGAAGGTCCAGCAGGATTGCTGCGCAACCACAACCGGATCCCCCAGCGCCCAAACCCCAGAGGAAGGCG
TCTTCCTCGAAGAAACGTGCTGCGGAGGAGCCGGCTGCTGAAGAAAAGAGCGCAGAATCGTCCTCGAAAAAG
GTAGGTGGTCGATAGTCAGAGCATGGTCAGGTTTTTTCGAGACCTGAC
TTTGAGGCTTGAGCCCCTTTTCCTCGTTATCGATTGGAAGCTGATGACAAGCTGATGATGGTTTTTTGTGGTGTTTGTAGGCGAAATCAGACTCTGACGAGGCTGGTAATGGTGACGAGG
CAGCTAGTCTCCAGCCGATAGATATCGGTGATAGCCTCCCTTCTCTAGTTCTCAAGAATGAGAAGGGAGAGGACATCCAGATCGCTGATCTGGCCAAGGAGAAGGGTGTCGTCCTTTTCC
TCGTTCCCAGGGCCGATACGC
GTAAGTCTGATCCCAAAAACAAGCTCTATGTAAAGGATCGGGAATTCAAGTTGACCTCATGGTGATATGGCAGCCGGCTGCACAACCCAGGCCTGTGGC
TTCAGGGACATCTACCCCGATTTCTCGTCCGTCAACTTCGACGTGTACTGTTTAAGCGCGGATTCTCCCACTGCGCAGACGAAGTGGCAGACAAAG
GTGAGGTGTTACCGCCCGTCGTAT
TGCATGCTGCCGCAGCTTTCGCCCTGGATGGAACTGTGACTGACCGGACCTTGGGGACTGTGACAGAAAGAGCTCCCGTATTCCCTCATTTCTGATCCCAAGCGCAGCTTGATCGCAGCC
TTGGGAGCTAGCGAGGGTGGAAAGACGAAGCGCAGCCACTTCATCTTTGAAAAAGGTGGTAAATTGGTGGAGAAAAGGAATCCTGTCAAGCCTGGGGAAAG
GTAAGCCGTTTTGTGCTGC
GTCGGAGCGGGAGAGGGCCCTAATAAATTGCATCCGGTATAGTCCTCAGTTGGCCCTCGAATTCATCAAGGGTCTCGAGAGCAAGGCAGAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGCCCGTGCCAAGTCGAGTGAAGGTGCTGCGTCGGCTGAGCCTCCGAGAAGGTCCAGCAGGATTGCTGCGCAACCACAACCGGATCCCCCAGCGCCCAAACCCCAGAGGAAGGCG
TCTTCCTCGAAGAAACGTGCTGCGGAGGAGCCGGCTGCTGAAGAAAAGAGCGCAGAATCGTCCTCGAAAAAG
GCGAAATCAGACTCTGACGAGGCTGGTAATGGTGACGAGGCAGCTAGT
CTCCAGCCGATAGATATCGGTGATAGCCTCCCTTCTCTAGTTCTCAAGAATGAGAAGGGAGAGGACATCCAGATCGCTGATCTGGCCAAGGAGAAGGGTGTCGTCCTTTTCCTCGTTCCC
AGGGCCGATACGC
CCGGCTGCACAACCCAGGCCTGTGGCTTCAGGGACATCTACCCCGATTTCTCGTCCGTCAACTTCGACGTGTACTGTTTAAGCGCGGATTCTCCCACTGCGCAGACG
AAGTGGCAGACAAAG
AAAGAGCTCCCGTATTCCCTCATTTCTGATCCCAAGCGCAGCTTGATCGCAGCCTTGGGAGCTAGCGAGGGTGGAAAGACGAAGCGCAGCCACTTCATCTTTGAA
AAAGGTGGTAAATTGGTGGAGAAAAGGAATCCTGTCAAGCCTGGGGAAAG
TCCTCAGTTGGCCCTCGAATTCATCAAGGGTCTCGAGAGCAAGGCAGAGTGA

Retrieve as FASTA