Entry information : CcinFRe02
Entry ID 6528
Creation 2009-01-24 (Christophe Dunand)
Last sequence changes 2009-01-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-02 (Christophe Dunand)
Peroxidase information: CcinFRe02
Name CcinFRe02
Class Ferric Reductase    [Orthogroup: FRe001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinFRe02
start..stop
S start..stop
CcinFRe01 664 0 35..537 1..522
CcinFRe03 593 0 45..537 158..674
CcinFRe04 567 0 38..537 190..711
PcFRe01 160 2e-42 59..537 243..753
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2224093..2224148 56 N° 2 2224204..2225761 1558  
join(2224093..2224148,2224204..2225761)


exon

Literature and cross-references CcinFRe02
DNA ref. JGI genome:   Chr_8 (2224093..2225758)
Protein sequence: CcinFRe02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   537
PWM (Da):   %s   60181.52 Transmb domain:   %s   o20-39i79-101o116-138i159-181o191-213i220-242o252-269i413-435o
PI (pH):   %s   8.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYNGLGWHERSQRDHGWNGIAVAVSSVCIPIVFSLFRFLPARPLWYSRLVNVLEMPLMGNRHRTPIVANLGIMPTRGQTLYLVYLLATQIFLGIFPLTFIYPNFNVDDDTEAVLKIIGDRTGVLAMADFVALFLFSSRNNVLLWITNWSHSTFLLLHRWIAYCCIFHTSIHSLFMLILVWDSYDKQIKRAYWIWGVIGTFAFVFIWPLSILPVRRKAYEFFLVTHQFLAIFGLLGTFIHIYRLYKYDWGYEIWVYIGALLWLVDRFVRIVRMVSNGYRKAVVTAVDPSAEYIQVDIDGIVAEGHVYLYFPTLSWRIWENHPYSVLSSFKGGPTTRKTVTQGNGEKSSQPSSTMSSSDESVAGNAGPRVTLLVRPMDGFSKTLVNRLLASNGRLTLPVFVESSYHANPSAHGELAHCSTLLCIAGGVGITAVLPIIKTFGGVRARLAWGVRNEWLIRAVEPELNTLNSLTVEVETSVGSRLPIVDILKEELQKDDVEGDLGVVACGPTGMADEIRVAIGQLGPKAKRGVVFVDDAFSW

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST. Strain="okayama7#130".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACAACGGCCTGGGCTGGCATGAGCGAAGCCAGAGAGACCACGGTTGGAATGGGTAAGTGGTAGCTCCTTCGTCGACTGACTCCAAGTTTACTGACTGCATTTTCCAGAATCGCTGT
CGCAGTCAGCAGTGTCTGCATCCCGATCGTCTTCTCTCTATTCCGTTTCCTCCCCGCTCGACCTCTATGGTATAGCCGCCTGGTCAACGTGCTCGAGATGCCACTCATGGGCAACCGTCA
CCGCACTCCGATCGTCGCAAACCTCGGCATCATGCCCACCCGTGGCCAAACGCTCTACCTCGTCTACCTCCTCGCCACCCAAATCTTCCTCGGCATCTTCCCATTGACCTTCATCTACCC
AAACTTCAACGTCGATGACGACACCGAAGCCGTATTGAAGATCATCGGAGACCGAACGGGTGTCCTCGCCATGGCGGACTTTGTCGCCCTCTTCCTCTTCTCCTCGAGGAACAATGTCCT
TCTCTGGATCACCAACTGGAGCCACAGCACGTTCCTGCTCCTCCATCGCTGGATCGCCTATTGCTGCATCTTCCACACGTCGATTCACTCCCTCTTCATGCTGATTCTGGTTTGGGACAG
CTATGACAAGCAGATCAAGCGAGCATACTGGATTTGGGGTGTCATCGGCACCTTCGCCTTTGTGTTCATCTGGCCTCTCTCAATCCTCCCTGTTCGTCGCAAGGCCTACGAGTTCTTCCT
CGTCACACACCAATTCCTCGCCATCTTCGGCCTCCTCGGCACTTTCATCCACATCTACCGCCTATACAAGTACGATTGGGGCTACGAGATCTGGGTGTATATCGGAGCTCTCCTCTGGCT
CGTCGATCGTTTCGTTCGAATTGTGCGCATGGTCTCCAACGGATACCGCAAGGCCGTCGTCACTGCCGTCGACCCCAGCGCAGAGTACATCCAAGTCGACATCGACGGTATCGTCGCCGA
GGGCCACGTCTACCTCTACTTCCCTACCCTCAGCTGGCGTATCTGGGAGAACCACCCCTACTCCGTCCTGTCGAGCTTCAAGGGTGGCCCGACCACTCGCAAGACCGTCACCCAGGGCAA
TGGAGAGAAGAGCAGCCAGCCCAGTTCCACGATGTCTTCAAGCGACGAGTCGGTGGCGGGCAACGCAGGGCCCCGGGTGACCCTCCTCGTTCGGCCCATGGATGGGTTCAGCAAGACGCT
CGTTAACCGCCTTCTTGCATCCAACGGACGACTCACTCTTCCCGTCTTCGTCGAGTCTTCGTATCACGCCAACCCTTCTGCCCATGGCGAACTCGCCCACTGCTCTACCCTCCTCTGTAT
CGCTGGTGGCGTCGGTATCACCGCTGTCCTACCCATTATCAAGACCTTCGGAGGTGTTCGTGCCCGATTGGCATGGGGTGTACGCAACGAGTGGCTCATCCGCGCTGTCGAGCCCGAGCT
TAACACTCTGAACTCCTTGACTGTCGAGGTTGAAACTAGTGTCGGCTCAAGACTGCCCATTGTGGACATCCTGAAGGAGGAGCTGCAGAAGGATGATGTGGAGGGTGATTTGGGTGTGGT
GGCCTGTGGACCGACTGGCATGGCTGACGAAATCCGCGTTGCGATTGGACAACTTGGTCCCAAGGCGAAGAGAGGTGTCGTGTTTGTTGACGATGCGTTCAGCTGGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACAACGGCCTGGGCTGGCATGAGCGAAGCCAGAGAGACCACGGTTGGAATGGAATCGCTGTCGCAGTCAGCAGTGTCTGCATCCCGATCGTCTTCTCTCTATTCCGTTTCCTCCCC
GCTCGACCTCTATGGTATAGCCGCCTGGTCAACGTGCTCGAGATGCCACTCATGGGCAACCGTCACCGCACTCCGATCGTCGCAAACCTCGGCATCATGCCCACCCGTGGCCAAACGCTC
TACCTCGTCTACCTCCTCGCCACCCAAATCTTCCTCGGCATCTTCCCATTGACCTTCATCTACCCAAACTTCAACGTCGATGACGACACCGAAGCCGTATTGAAGATCATCGGAGACCGA
ACGGGTGTCCTCGCCATGGCGGACTTTGTCGCCCTCTTCCTCTTCTCCTCGAGGAACAATGTCCTTCTCTGGATCACCAACTGGAGCCACAGCACGTTCCTGCTCCTCCATCGCTGGATC
GCCTATTGCTGCATCTTCCACACGTCGATTCACTCCCTCTTCATGCTGATTCTGGTTTGGGACAGCTATGACAAGCAGATCAAGCGAGCATACTGGATTTGGGGTGTCATCGGCACCTTC
GCCTTTGTGTTCATCTGGCCTCTCTCAATCCTCCCTGTTCGTCGCAAGGCCTACGAGTTCTTCCTCGTCACACACCAATTCCTCGCCATCTTCGGCCTCCTCGGCACTTTCATCCACATC
TACCGCCTATACAAGTACGATTGGGGCTACGAGATCTGGGTGTATATCGGAGCTCTCCTCTGGCTCGTCGATCGTTTCGTTCGAATTGTGCGCATGGTCTCCAACGGATACCGCAAGGCC
GTCGTCACTGCCGTCGACCCCAGCGCAGAGTACATCCAAGTCGACATCGACGGTATCGTCGCCGAGGGCCACGTCTACCTCTACTTCCCTACCCTCAGCTGGCGTATCTGGGAGAACCAC
CCCTACTCCGTCCTGTCGAGCTTCAAGGGTGGCCCGACCACTCGCAAGACCGTCACCCAGGGCAATGGAGAGAAGAGCAGCCAGCCCAGTTCCACGATGTCTTCAAGCGACGAGTCGGTG
GCGGGCAACGCAGGGCCCCGGGTGACCCTCCTCGTTCGGCCCATGGATGGGTTCAGCAAGACGCTCGTTAACCGCCTTCTTGCATCCAACGGACGACTCACTCTTCCCGTCTTCGTCGAG
TCTTCGTATCACGCCAACCCTTCTGCCCATGGCGAACTCGCCCACTGCTCTACCCTCCTCTGTATCGCTGGTGGCGTCGGTATCACCGCTGTCCTACCCATTATCAAGACCTTCGGAGGT
GTTCGTGCCCGATTGGCATGGGGTGTACGCAACGAGTGGCTCATCCGCGCTGTCGAGCCCGAGCTTAACACTCTGAACTCCTTGACTGTCGAGGTTGAAACTAGTGTCGGCTCAAGACTG
CCCATTGTGGACATCCTGAAGGAGGAGCTGCAGAAGGATGATGTGGAGGGTGATTTGGGTGTGGTGGCCTGTGGACCGACTGGCATGGCTGACGAAATCCGCGTTGCGATTGGACAACTT
GGTCCCAAGGCGAAGAGAGGTGTCGTGTTTGTTGACGATGCGTTCAGCTGGTAG

Retrieve as FASTA