Entry information : LbiKat01 (LbCAT)
Entry ID 6529
Creation 2009-01-30 (Christophe Dunand)
Last sequence changes 2012-04-06 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-10 (Christophe Dunand)
Peroxidase information: LbiKat01 (LbCAT)
Name (synonym) LbiKat01 (LbCAT)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue types Mycelium
Sporocarp (fruiting body)
Inducer Infected host
Repressor N/D
Best BLASTp hits
Perox score E-value LbiKat01
start..stop
S start..stop
CcinKat01 904 0 1..521 1..521
AbKat01_bisporus 888 0 14..520 8..514
PscKat01 872 0 1..520 1..521
SbreKat01 835 0 1..520 1..520
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 135733..135856 124 N° 2 135907..135965 59 N° 3 136020..136349 330 N° 4 136401..136580 180
N° 5 136638..136751 114 N° 6 136804..136953 150 N° 7 137012..137360 349 N° 8 137415..137540 126
N° 9 137596..137753 158  
join(135733..135856,135907..135965,136020..136349,136401..136580,136638..136751, 136804..136953,137012..137360,137415..137540,137596..137753)


exon

Literature and cross-references LbiKat01 (LbCAT)
Literature Martin,F., et al. The genome of Laccaria bicolor provides insights into mycorrhizal symbiosis. Nature 452 (7183), 88-92 (2008).
Protein ref. GenBank:   6085152
DNA ref. JGI genome:   scaffold_20 (135733..137753)
mRNA ref. GenBank:   XM_001889460
EST ref. GenBank:   EX789580.1 [5' end]   EX799114.1 [3' end]   EX800483.1 [Fragment]
Protein sequence: LbiKat01 (LbCAT)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   529
PWM (Da):   %s   59534.01  
PI (pH):   %s   6.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPSQQVFSTQDGAVYTTSNGAPVAEPYAAQRAGRLGPLLLQDFHHIDLLAHFDRERIPERVHAKGAGAHGYFEVTHDLSDITSQSLFQGVGKKVRATVRFSTVGGESGSADTARDPRGFSIKLRTEEGNWDWVFNNTPVFFIRDPAKFPQFIHTQKRDPQTHLKDADVFWDYLSQNPESIHQIMILFSDRGTPDGYHQEHGYSGHTFKWVKDDGSFVYVQVHLRAGGGFKTLDDATATRLAGENPDYGTQNLFEAIEAGKYPIWNVFIQTMTPEQAENFRYNILDLTKVWPHGEFPLRPIGKLVLDENPKNYFAEIEQVAFSPSHLIPYIEPSADPVLQSRLFSYPDTHRHRLGPNYQQLPVNAPLNPVANFQRDGPAAFISQGNRPNYQSSIQTLTYAEKKGAIDSSARDLEREERHETFIGGAWRDLSEVTELDFEQPRALWSKVWDDKARETYVQNVAGHFKNVKSAEVKARQLSVWAAVDQELSDRIAAAVGHRPVKPLEVKPASEAVKFRANLGYNVLNKQSS

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns) and 9 ESTs. Strain="S238N-H82".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTCACAGCAAGTTTTTTCCACTCAGGACGGTGCCGTTTACACAACTTCCAACGGTGCTCCCGTCGCCGAGCCCTATGCTGCTCAAAGAGCCGGCCGTCTGGGGCCCCTGTTGCTT
CAAG
GTGTGCCCAATGCATACCGTCGCCACTAGGTTTAGATTTTAGATTTTTAGATTTCCACCATATCGATCTTCTCGCACACTTTGACCGCGAGCGTATCCCAGAGCGTGTTGTGAGTC
GCAATCCTTCATCGAGACTGACTCACGACGTTGACCATGCCATCTAGGTTCACGCGAAAGGTGCTGGTGCACATGGTTACTTTGAGGTCACACACGACCTCAGTGACATCACCTCCCAGT
CTCTTTTCCAGGGCGTAGGCAAGAAGGTTCGCGCTACAGTCCGCTTCTCCACCGTTGGTGGTGAATCTGGTTCAGCGGACACTGCTCGTGACCCCCGTGGCTTTTCAATCAAGCTAAGGA
CTGAAGAGGGCAACTGGGACTGGGTTTTCAATAACACCCCTGTCTTCTTTATTCGCGATCCTGCCAAATTTCCCCAGTTCATACACACCCAGAAGAGGGATCCCCAGACCCACCTGAAGG
ATGCCGATGTGTTTTGG
GTATGTATATGCGCTTCGTTTGATTAGTTCATTCATCTCACGCGTTCGCAGGACTATCTTTCTCAAAACCCAGAGTCGATCCACCAGATCATGATCCTCTTCT
CTGATCGTGGAACTCCAGACGGCTATCACCAGGAGCACGGGTACTCCGGACACACCTTCAAGTGGGTCAAGGATGACGGTTCCTTTGTGTACGTCCAAGTTCACCTTCGTGCTGGGGGCG
GTTTCAAG
GTACGCGATTGTTCTGCCACCTGCGCTGAAGGATGACTCAAACTTGTCTACCCACAGACCCTCGACGATGCAACCGCAACCCGCCTTGCTGGTGAGAATCCAGACTACGGTA
CTCAAAACCTGTTCGAGGCCATCGAAGCCGGCAAATACCCAATCTGGAACGTGTTCATT
GTGGGTCGTGTTGCAATATTGACACAAAACATGCTGCTCATCGTTTATCTAGCAAACCATG
ACTCCGGAGCAAGCTGAGAATTTCCGCTACAACATCCTCGATCTTACCAAAGTCTGGCCACACGGCGAGTTCCCCCTTCGGCCCATTGGGAAACTTGTTCTCGACGAGAACCCCAAAAAC
TATTTCGCCGAGATCGAGCAG
GTGGGTTTTCACTACCCGCCAATAACCCAGTGATTGAACTCATTATGCTCATGGCCAGGTTGCATTCTCACCATCCCATCTCATACCCTACATCGAGCC
TTCCGCCGATCCCGTCCTGCAGTCGCGTCTCTTCTCTTACCCTGACACACACCGCCACCGCCTTGGCCCCAACTATCAGCAATTGCCAGTCAACGCACCACTCAACCCCGTTGCCAACTT
CCAGCGCGACGGACCTGCCGCCTTCATTTCGCAGGGTAACCGGCCCAACTACCAGAGCTCGATCCAGACCCTCACATACGCGGAGAAGAAGGGAGCCATCGATTCTTCTGCCCGAGACTT
GGAACGTGAGGAGAGGCATGAGACTTTTATTGGCGGTGCTTGGAGAGATTTGAGCGAGGTCACTGAAC
GTGGGTGATTCTCAGATGATCGACACCCATTTTACTGAATATATGCGTTGGT
AGTTGACTTTGAGCAACCCCGGGCCTTGTGGAGCAAGGTCTGGGACGACAAGGCCCGAGAGACGTATGTACAAAACGTCGCTGGCCACTTCAAGAATGTCAAGAGTGCGGAAGTCAAGGC
GAGGCAAC
GTACGTTTTAACGTATTCCTTCCCCCTCTTTGAACGATGCTCACCTATCCCATAGTTTCTGTTTGGGCCGCTGTCGATCAAGAGTTATCCGACCGCATCGCTGCTGCTGTTG
GCCATCGCCCTGTGAAGCCTCTCGAAGTCAAACCTGCCAGCGAGGCCGTCAAGTTCCGAGCCAATCTAGGTTATAACGTGCTCAACAAGCAAAGCTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTCACAGCAAGTTTTTTCCACTCAGGACGGTGCCGTTTACACAACTTCCAACGGTGCTCCCGTCGCCGAGCCCTATGCTGCTCAAAGAGCCGGCCGTCTGGGGCCCCTGTTGCTT
CAAG
ATTTCCACCATATCGATCTTCTCGCACACTTTGACCGCGAGCGTATCCCAGAGCGTGTTGTTCACGCGAAAGGTGCTGGTGCACATGGTTACTTTGAGGTCACACACGACCTCAGT
GACATCACCTCCCAGTCTCTTTTCCAGGGCGTAGGCAAGAAGGTTCGCGCTACAGTCCGCTTCTCCACCGTTGGTGGTGAATCTGGTTCAGCGGACACTGCTCGTGACCCCCGTGGCTTT
TCAATCAAGCTAAGGACTGAAGAGGGCAACTGGGACTGGGTTTTCAATAACACCCCTGTCTTCTTTATTCGCGATCCTGCCAAATTTCCCCAGTTCATACACACCCAGAAGAGGGATCCC
CAGACCCACCTGAAGGATGCCGATGTGTTTTGG
GACTATCTTTCTCAAAACCCAGAGTCGATCCACCAGATCATGATCCTCTTCTCTGATCGTGGAACTCCAGACGGCTATCACCAGGAG
CACGGGTACTCCGGACACACCTTCAAGTGGGTCAAGGATGACGGTTCCTTTGTGTACGTCCAAGTTCACCTTCGTGCTGGGGGCGGTTTCAAG
ACCCTCGACGATGCAACCGCAACCCGC
CTTGCTGGTGAGAATCCAGACTACGGTACTCAAAACCTGTTCGAGGCCATCGAAGCCGGCAAATACCCAATCTGGAACGTGTTCATT
CAAACCATGACTCCGGAGCAAGCTGAGAATTTC
CGCTACAACATCCTCGATCTTACCAAAGTCTGGCCACACGGCGAGTTCCCCCTTCGGCCCATTGGGAAACTTGTTCTCGACGAGAACCCCAAAAACTATTTCGCCGAGATCGAGCAG
GTT
GCATTCTCACCATCCCATCTCATACCCTACATCGAGCCTTCCGCCGATCCCGTCCTGCAGTCGCGTCTCTTCTCTTACCCTGACACACACCGCCACCGCCTTGGCCCCAACTATCAGCAA
TTGCCAGTCAACGCACCACTCAACCCCGTTGCCAACTTCCAGCGCGACGGACCTGCCGCCTTCATTTCGCAGGGTAACCGGCCCAACTACCAGAGCTCGATCCAGACCCTCACATACGCG
GAGAAGAAGGGAGCCATCGATTCTTCTGCCCGAGACTTGGAACGTGAGGAGAGGCATGAGACTTTTATTGGCGGTGCTTGGAGAGATTTGAGCGAGGTCACTGAAC
TTGACTTTGAGCAA
CCCCGGGCCTTGTGGAGCAAGGTCTGGGACGACAAGGCCCGAGAGACGTATGTACAAAACGTCGCTGGCCACTTCAAGAATGTCAAGAGTGCGGAAGTCAAGGCGAGGCAAC
TTTCTGTT
TGGGCCGCTGTCGATCAAGAGTTATCCGACCGCATCGCTGCTGCTGTTGGCCATCGCCCTGTGAAGCCTCTCGAAGTCAAACCTGCCAGCGAGGCCGTCAAGTTCCGAGCCAATCTAGGT
TATAACGTGCTCAACAAGCAAAGCTCGTAA

Retrieve as FASTA