Entry information : PpaKat03
Entry ID 6567
Creation 2009-02-01 (Christophe Dunand)
Last sequence changes 2009-02-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-02 (Christophe Dunand)
Peroxidase information: PpaKat03
Name PpaKat03
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type Protonema
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaKat03
start..stop
S start..stop
PpaKat04 907 0 9..486 57..534
PpaKat05 881 0 9..486 36..513
MpKat02 838 0 9..486 124..601
SmKat03-1_34 750 0 9..486 41..517
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 150982..151157 176 N° 2 151280..151598 319 N° 3 151715..152245 531 N° 4 152423..152583 161
N° 5 152728..153001 274  
join(150982..151157,151280..151598,151715..152245,152423..152583,152728..153001)


exon

Literature and cross-references PpaKat03
Literature Rensing,S.A., etal., The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science 319 (5859), 64-69 (2008).
DNA ref. Phytozome 11:   scaffold_292 (150982..153001)
mRNA ref. GenBank:   XM_001780939
Cluster/Prediction ref. UniGene:   Ppa.17618 [3' end]
Protein sequence: PpaKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   486
PWM (Da):   %s   55096.17  
PI (pH):   %s   6.77
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLNPLALNLSLTVGESGTVTLEDLHLFEKNAHFNRERVPERVVHAKGAGAHGYFEVTKDVSDLCKAGLFSEVGKRTPVFARFSTVTGESGYADTARDPRGFSLKFYTEEGNWDMVGNNTPVFFVRDAAKFPDLIHSQKRNPQTHMKDPNAFWDFLSLVPESLHVLITFSPRGVPDGHRHMHGYGSHTFKWVNKEGKAHWVKFHFISDQGIKNLTHERAVELAGINPDYSTEDLFQNIQNGNGPSWTFKVQVMPLEDAPSYRWDPFDLTKVWPHADYPLREVGKLKLDRNPTNYFAEVEQASFSPAHMVPGIEASPDRVLQFRLFAYDDAARYRIGGNYLQVPINQCPFAKVQNYSRDGQMTVTDNGGSKPNYYPNSHEELPRPDPSQPEVHPYEHAGGTVSKAPPRKWSEQDDYEQPRMLWQKMSKEDQGQTAKNIAGHIQGAKESIIERQMGVFRRCDPSLADKVEEMLGMKKKSEDPYTMVA

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns), 1 mRNA and 8 ESTs. Incorrecet prediction from Phytozome (two extra exons in 5'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTGAACCCTTTGGCACTCAATCTCAGCCTGACAGTTGGTGAGAGCGGGACCGTGACTCTGGAGGATTTGCACTTGTTCGAGAAGAACGCACATTTCAATCGCGAGCGCGTCCCC
GAGCGCGTGGTGCATGCGAAGGGTGCTGGCGCCCATGGCTACTTCGAAGTGACCAA
GTAAGCAACTCACCGCCGATGTCTCTGTCGGAACCCGTCGGACCTTGATTTGTGGATACGTGCA
GGGTGATTCCCGAAGCTGCAGCTGAACTGTTTCCCCATTGCGTTTGTTTCGTCTCCAGGGACGTGAGTGATCTCTGCAAGGCGGGGCTCTTCAGCGAAGTCGGCAAGAGAACTCCGGTAT
TCGCCCGCTTTTCTACCGTGACCGGAGAGTCAGGGTATGCGGACACGGCGAGGGACCCTCGTGGTTTCTCGCTCAAGTTCTACACGGAGGAGGGCAATTGGGATATGGTGGGTAACAACA
CCCCGGTGTTCTTCGTCCGCGACGCGGCGAAGTTCCCGGACCTCATCCACTCCCAGAAGCGCAACCCACAGACCCACATGAAAGACCCCAACGCTTTCTGGGATTTTCTCAGCCTAGTTC
CCGAGTCTCTGCATCAG
GTAGAGAGCTCCGCCGTTCTCGATTTCCTTTCCAATTTTGCTGTCGTTGCGAGTCTTCTCTTCGTCACGAAGTCTTATAGCGTCCCTGAACTTGGACCGGCTG
CGGCTTTTCTCAGGTGTTGATCACTTTCTCGCCCCGGGGAGTTCCCGATGGTCATCGTCACATGCACGGCTATGGCTCCCACACATTCAAGTGGGTAAACAAGGAAGGGAAAGCTCACTG
GGTGAAGTTTCACTTCATCAGCGACCAAGGCATCAAGAATCTGACTCACGAGCGAGCCGTTGAGCTTGCGGGAATCAACCCCGACTACTCCACCGAGGATCTCTTCCAGAACATCCAAAA
CGGTAATGGGCCGTCGTGGACATTCAAGGTGCAGGTGATGCCTCTGGAGGATGCGCCTTCGTACCGATGGGATCCATTCGATTTGACCAAGGTGTGGCCACACGCGGACTACCCGCTGCG
CGAAGTAGGGAAGCTAAAGCTGGACCGAAATCCGACCAACTACTTCGCCGAAGTGGAGCAAGCATCGTTCTCACCAGCACACATGGTGCCTGGAATCGAAGCTTCTCCCGATCGTGTGCT
TCAGTTCCGTCTGTTCGCATACGATGACGCCGCCCGGTATCGCATAGGAGGGAATTATTTGCAG
GTACATCTATCTTCCGGGGAGCTTGAAAATCACCTAAAATATCTGCTGGAATTTAT
TGAATCGTTTTGGAAGACAATTGTGGATTCGAACGTCTGCGTGTGCGTTACTGAATTCGTCGCAGTAACGGTTGTCTGCGAATGCTTTTTGAGTCCGGTTGCTTTGCCGTGGCGTGTACA
GGTTCCAATCAACCAGTGTCCGTTTGCGAAAGTGCAAAACTATTCTCGTGACGGGCAGATGACAGTGACCGACAACGGTGGAAGCAAGCCCAACTACTACCCCAACTCACACGAAGAGTT
GCCACGTCCCGATCCTTCTCAACCCGAAGTGCACCCCTACGA
GTACGGTCACTGCCTTGGTCGCAAGTCTTTGTCGATCCCTTCTGATTTCGGTTGCGTGAGCGGGTGATGTTGATCTCA
TTCGAATACACCGAATACAGTTTGTGGAGGTTCGCCCCTGACAGTGTTGGAATTGTGGTCGTGCAGGCATGCAGGAGGAACCGTGTCTAAAGCTCCGCCCCGCAAGTGGTCCGAGCAAGA
TGACTATGAACAGCCAAGGATGCTGTGGCAGAAGATGTCGAAGGAAGACCAGGGGCAGACAGCTAAAAACATTGCTGGGCACATCCAGGGTGCCAAGGAGTCCATCATTGAGCGTCAGAT
GGGAGTGTTCAGACGCTGCGACCCGTCTCTGGCTGACAAGGTGGAGGAGATGTTGGGAATGAAGAAGAAATCTGAGGACCCATACACCATGGTGGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTGAACCCTTTGGCACTCAATCTCAGCCTGACAGTTGGTGAGAGCGGGACCGTGACTCTGGAGGATTTGCACTTGTTCGAGAAGAACGCACATTTCAATCGCGAGCGCGTCCCC
GAGCGCGTGGTGCATGCGAAGGGTGCTGGCGCCCATGGCTACTTCGAAGTGACCAA
GGACGTGAGTGATCTCTGCAAGGCGGGGCTCTTCAGCGAAGTCGGCAAGAGAACTCCGGTATTC
GCCCGCTTTTCTACCGTGACCGGAGAGTCAGGGTATGCGGACACGGCGAGGGACCCTCGTGGTTTCTCGCTCAAGTTCTACACGGAGGAGGGCAATTGGGATATGGTGGGTAACAACACC
CCGGTGTTCTTCGTCCGCGACGCGGCGAAGTTCCCGGACCTCATCCACTCCCAGAAGCGCAACCCACAGACCCACATGAAAGACCCCAACGCTTTCTGGGATTTTCTCAGCCTAGTTCCC
GAGTCTCTGCATCAG
GTGTTGATCACTTTCTCGCCCCGGGGAGTTCCCGATGGTCATCGTCACATGCACGGCTATGGCTCCCACACATTCAAGTGGGTAAACAAGGAAGGGAAAGCTCAC
TGGGTGAAGTTTCACTTCATCAGCGACCAAGGCATCAAGAATCTGACTCACGAGCGAGCCGTTGAGCTTGCGGGAATCAACCCCGACTACTCCACCGAGGATCTCTTCCAGAACATCCAA
AACGGTAATGGGCCGTCGTGGACATTCAAGGTGCAGGTGATGCCTCTGGAGGATGCGCCTTCGTACCGATGGGATCCATTCGATTTGACCAAGGTGTGGCCACACGCGGACTACCCGCTG
CGCGAAGTAGGGAAGCTAAAGCTGGACCGAAATCCGACCAACTACTTCGCCGAAGTGGAGCAAGCATCGTTCTCACCAGCACACATGGTGCCTGGAATCGAAGCTTCTCCCGATCGTGTG
CTTCAGTTCCGTCTGTTCGCATACGATGACGCCGCCCGGTATCGCATAGGAGGGAATTATTTGCAG
GTTCCAATCAACCAGTGTCCGTTTGCGAAAGTGCAAAACTATTCTCGTGACGGG
CAGATGACAGTGACCGACAACGGTGGAAGCAAGCCCAACTACTACCCCAACTCACACGAAGAGTTGCCACGTCCCGATCCTTCTCAACCCGAAGTGCACCCCTACGA
GCATGCAGGAGGA
ACCGTGTCTAAAGCTCCGCCCCGCAAGTGGTCCGAGCAAGATGACTATGAACAGCCAAGGATGCTGTGGCAGAAGATGTCGAAGGAAGACCAGGGGCAGACAGCTAAAAACATTGCTGGG
CACATCCAGGGTGCCAAGGAGTCCATCATTGAGCGTCAGATGGGAGTGTTCAGACGCTGCGACCCGTCTCTGGCTGACAAGGTGGAGGAGATGTTGGGAATGAAGAAGAAATCTGAGGAC
CCATACACCATGGTGGCTTAA

Retrieve as FASTA