Entry information : SbPrx03 (Sobic.001G080300.1[2.1] / SB01G007240[1.4])
Entry ID 660
Creation 2005-12-26 (Christophe Dunand)
Last sequence changes 2005-12-26 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-01 (Messaoudi)
Peroxidase information: SbPrx03 (Sobic.001G080300.1[2.1] / SB01G007240[1.4])
Name (synonym) SbPrx03 (Sobic.001G080300.1[2.1] / SB01G007240[1.4])
Class Class III peroxidase    [Orthogroup: Prx097]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Callus
Cell culture
Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Ethylene treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx03
start..stop
S start..stop
ZmPrx108_35A19 570 0 29..334 24..330
SiPrx160 569 0 27..334 19..326
ZmPrx108 566 0 29..334 22..328
ZmPrx141 551 0 29..334 26..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6190662..6191096 435 N° 2 6190003..6190572 570  
complement(join(6190003..6190572,6190662..6191096))


exon

Literature and cross-references SbPrx03 (Sobic.001G080300.1[2.1] / SB01G007240[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_1 (6191096..6190003)
Protein sequence: SbPrx03 (Sobic.001G080300.1[2.1] / SB01G007240[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (301)
PWM (Da):   %s   35127.56 (32063.9) Transmb domain:   %s   i13-32o
PI (pH):   %s   6.98 (6.35) Peptide Signal:   %s   cut: 34 range:34-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARPSASSKASSSSLVILAIVVAAASLAQPGAADLKLNYYASTCPNVETIVRGAVQQRVQATIRTVGSTVRLFFHDCFVEGCDASVLIDSTPGNQAEKDASDNKSLAPEGFDTVRSAKAAVEAACPGTVSCADVLALATRDAISMSGGPFFQVELGRLDGLSSRASSVPGQLPEPNQTMDQLLAVFKAHGLDMSDLVALSAAHSVGLAHCSKFANRLYSFQPGQPTDPTLNPKYAQFLQSKCPNGGADNLVLMDQASPAQFDNQYYRNLQDGGGLLGSDELLYTDNRTRPMVDSLANSTAAFNQAFADAIVRLGRVGVKSGRRGNIRKQCHVFN*

Retrieve as FASTA  
Remarks Complete genomic (chromo 1, intron 2) and 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGCCGTCGGCAAGCAGCAAGGCGTCGTCGTCGTCGCTGGTGATCCTCGCGATCGTCGTCGCCGCCGCGTCCCTCGCGCAGCCCGGCGCGGCCGACCTGAAGCTGAACTACTAC
GCGAGCACCTGCCCCAACGTGGAGACCATCGTGCGCGGCGCGGTGCAGCAGAGGGTGCAGGCCACCATCCGCACCGTCGGCTCCACCGTCCGCCTCTTCTTCCACGACTGCTTCGTCGAG
GGCTGCGACGCCTCGGTGCTCATCGACTCCACGCCCGGCAACCAGGCCGAGAAGGACGCCTCCGACAACAAGTCCCTCGCGCCCGAAGGCTTCGACACCGTGCGCAGCGCCAAGGCCGCC
GTCGAGGCCGCCTGCCCTGGCACGGTCTCCTGCGCCGACGTGCTCGCCCTCGCCACTCGGGACGCCATCTCCATG
GTATATATATGGCATATCTAACTATATAGTTCCAGGCCCGATACA
GCATAATCGTACTAGTATATAACCTATCGTGCATGTGCATGCAGAGTGGCGGGCCTTTCTTCCAAGTGGAGCTGGGCAGGCTGGACGGCCTGAGCTCCAGGGCCAGCAGCGTGCCAGGCC
AGCTGCCCGAGCCGAACCAGACCATGGACCAGCTGCTGGCGGTCTTCAAGGCACACGGGCTCGACATGTCCGACCTCGTCGCGCTCTCAGCGGCGCACAGCGTGGGTCTGGCGCACTGCA
GCAAGTTCGCGAACCGGCTGTACAGCTTCCAGCCGGGGCAGCCGACGGACCCGACGCTGAACCCCAAGTACGCGCAGTTCCTGCAGAGCAAGTGCCCCAACGGCGGCGCCGACAACCTGG
TGCTCATGGACCAGGCCTCGCCGGCACAGTTCGACAACCAGTACTACCGGAACCTCCAGGACGGCGGCGGCCTGCTGGGCTCCGACGAGCTGCTCTACACCGACAACCGCACGCGCCCCA
TGGTGGACTCGCTGGCCAACAGCACCGCCGCCTTCAACCAGGCCTTCGCCGACGCCATCGTCAGGCTCGGCCGCGTCGGGGTCAAGTCCGGCAGGCGGGGCAACATCCGCAAGCAGTGCC
ACGTCTTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGCCGTCGGCAAGCAGCAAGGCGTCGTCGTCGTCGCTGGTGATCCTCGCGATCGTCGTCGCCGCCGCGTCCCTCGCGCAGCCCGGCGCGGCCGACCTGAAGCTGAACTACTAC
GCGAGCACCTGCCCCAACGTGGAGACCATCGTGCGCGGCGCGGTGCAGCAGAGGGTGCAGGCCACCATCCGCACCGTCGGCTCCACCGTCCGCCTCTTCTTCCACGACTGCTTCGTCGAG
GGCTGCGACGCCTCGGTGCTCATCGACTCCACGCCCGGCAACCAGGCCGAGAAGGACGCCTCCGACAACAAGTCCCTCGCGCCCGAAGGCTTCGACACCGTGCGCAGCGCCAAGGCCGCC
GTCGAGGCCGCCTGCCCTGGCACGGTCTCCTGCGCCGACGTGCTCGCCCTCGCCACTCGGGACGCCATCTCCATG
AGTGGCGGGCCTTTCTTCCAAGTGGAGCTGGGCAGGCTGGACGGC
CTGAGCTCCAGGGCCAGCAGCGTGCCAGGCCAGCTGCCCGAGCCGAACCAGACCATGGACCAGCTGCTGGCGGTCTTCAAGGCACACGGGCTCGACATGTCCGACCTCGTCGCGCTCTCA
GCGGCGCACAGCGTGGGTCTGGCGCACTGCAGCAAGTTCGCGAACCGGCTGTACAGCTTCCAGCCGGGGCAGCCGACGGACCCGACGCTGAACCCCAAGTACGCGCAGTTCCTGCAGAGC
AAGTGCCCCAACGGCGGCGCCGACAACCTGGTGCTCATGGACCAGGCCTCGCCGGCACAGTTCGACAACCAGTACTACCGGAACCTCCAGGACGGCGGCGGCCTGCTGGGCTCCGACGAG
CTGCTCTACACCGACAACCGCACGCGCCCCATGGTGGACTCGCTGGCCAACAGCACCGCCGCCTTCAACCAGGCCTTCGCCGACGCCATCGTCAGGCTCGGCCGCGTCGGGGTCAAGTCC
GGCAGGCGGGGCAACATCCGCAAGCAGTGCCACGTCTTCAACTGA

Retrieve as FASTA