Entry information : PEchCP01 (PechKatG)
Entry ID 6601
Creation 2009-02-19 (Marcel Zamocky)
Last sequence changes 2012-04-26 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-13 (Christophe Dunand)
Peroxidase information: PEchCP01 (PechKatG)
Name (synonym) PEchCP01 (PechKatG)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Penicillium
Organism Penicillium chrysogenum    [TaxId: 5076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PEchCP01
start..stop
S start..stop
LpaluCP01 1133 0 1..733 1..739
MvarCP02 1123 0 1..744 1..752
MbicCP02 1122 0 1..744 1..751
MmycCP1 1118 0 1..744 1..753
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2213064..2213119 56 N° 2 2213213..2213535 323 N° 3 2213599..2213636 38 N° 4 2213699..2215516 1818
join(2213064..2213119,2213213..2213535,2213599..2213636,2213699..2215516)


exon

Literature and cross-references PEchCP01 (PechKatG)
Literature REFERENCWE 1 Kiel,J.A., Veenhuis,M. and van der Klei,I.J. "PEX genes in fungal genomes: common, rare or redundant. Traffic 7 (10), 1291-1303 (2006).
REFERENCE 2 van den Berg,M.A., et al., Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 26 (10), 1161-1168 (2008).
Protein ref. GenBank:   CAP81001 UniProtKB:   B6H094
DNA ref. JGI genome:   scaffold_3 (2213064..2215516)
Protein sequence: PEchCP01 (PechKatG)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   744
PWM (Da):   %s   82262.22  
PI (pH):   %s   6.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSECPVAHKRSNVAGGGTRNTDWWPNSLKLGILRQHTDATNPQTKDFDYAAAFKTLDYWGLKKDLHALMTDSQEFWPADFGHYGGLFIRMAWHSAGTYRVFDGRGGGGQGQQRFAPLNSWPDNVSDKARRLLWPIKQYGNKISWADLLLLTGNVALESMGFKTFGFAGGRPDVWEADESVYWGSENVWFTNKARYEAETAEEEAKQGNIKTRDLEDPLAAVVMGLIYVNPEGPDGNGDPLSAARDIRITFGRMAMNDEETVALIAGGHTFGKTHGAAPADNVGTEPEAAGIESQGLGWHNKHGSGVGPHAITSGLEVTWTSTPTKWSNSFLEYLFKFEWEQTKSPAGATQWVAKNAGDIVPDAFDSSKKHRPHMLTTDLSLRYDPAYEKISRRFLENPDEFADAFARAWFKLLHRDMGPRARWLGPEIPKEVSLWEDPIPAPTYALIDNGDIIALKNEILSAGIEPTKLIATAWASASTFRGGDKRGGANGAHIRLAPQKDWDVNNPAQLQEVLGLLESIQGRFNKAQNGEKRVSIADLIVLAGSAALERAAGIPVPFTPGRNDATQEQTDVESFGWLRPFADGFRNYGNSTRRVRTEQLLIDKAQQLTLSAPELTVLLGGLRSLNANWDGSRDGVFTSRPGQLSNDFFVNLLDMSTVWKPTDADSEKFEGFDRKTGAKKWSATRVDLIFGHHAELRALSELYASSDAQDKFKKDFVAAWDKVMNMDRYDIPCFPATGRPRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Strain="Wisconsin 54-1255".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGAATGTCCTGTTGCGCACAAGAGAAGCAATGTTGCTGGAGGTGGCACCCGGTATGGCCCCTAGTTCTCTTATGACTTTACCTCGGCACACTTTATTTACCCCTTCGCATCGCTA
TGGCTCGAAATACTAATTCTATACTCCAGCAACACCGACTGGTGGCCCAATTCCTTGAAGTTGGGTATTCTCCGCCAGCATACTGATGCCACCAACCCTCAAACTAAGGACTTTGATTAT
GCCGCTGCCTTCAAGACCCTCGATTACTGGGGCCTCAAGAAGGATCTTCACGCCCTTATGACCGACTCTCAGGAGTTTTGGCCCGCTGATTTTGGCCACTATGGTGGCCTTTTCATCCGA
ATGGCCTGGCACAGCGCTGGAACATACAGAGTCTTCGATGGACGCGGTGGCGGTGGCCAGGGCCAGCAGCGTTTTGCACCATTGAACTCTTGGCCCGATAATGTCTCCCTTG
GTAAGTTT
TTATTAATAGTTGACGTGATTTTATATCATACTGATATGGATCTCCTATTTCCAGATAAGGCCCGCCGACTACTTTGGCCCATCAAGCAGAAGGTTGGTACTATACATGGAACTTGTGTA
TTTCCAGATTTCTCTATACTAACTATGGTATTTAGTACGGCAACAAAATCTCCTGGGCAGATCTTCTGCTTCTAACTGGAAACGTTGCCTTGGAGTCTATGGGTTTCAAGACATTCGGAT
TTGCTGGAGGTCGCCCCGACGTCTGGGAAGCCGATGAGTCGGTGTACTGGGGAAGCGAGAACGTCTGGTTTACTAATAAGGCTCGTTATGAGGCCGAGACCGCAGAGGAGGAGGCTAAGC
AGGGCAACATCAAGACTCGCGATCTCGAGGACCCACTGGCCGCGGTCGTCATGGGTTTGATTTATGTCAACCCTGAAGGTCCCGATGGAAACGGGGACCCTCTCTCTGCTGCCAGAGATA
TCCGTATTACATTCGGCCGTATGGCTATGAATGACGAAGAGACCGTCGCCTTGATTGCTGGAGGCCACACCTTCGGAAAAACGCACGGTGCTGCCCCTGCTGATAATGTCGGAACCGAGC
CCGAAGCTGCTGGCATTGAATCGCAAGGCCTGGGATGGCACAACAAGCACGGCTCCGGTGTAGGCCCCCATGCTATCACCAGTGGGTTGGAGGTGACCTGGACAAGTACCCCTACCAAGT
GGAGCAACTCCTTCTTGGAATATCTGTTCAAGTTCGAGTGGGAGCAGACCAAGAGTCCCGCTGGCGCTACGCAGTGGGTGGCCAAGAATGCGGGCGATATCGTCCCTGATGCCTTTGACT
CAAGCAAGAAGCACAGGCCTCATATGCTGACTACCGATCTTTCTCTGCGTTACGATCCCGCTTACGAGAAGATCTCCCGTCGCTTCCTTGAGAACCCTGATGAGTTTGCCGACGCATTCG
CCCGTGCGTGGTTCAAGCTGCTCCACCGTGACATGGGTCCTCGCGCTCGCTGGCTGGGCCCTGAGATCCCAAAGGAGGTCTCTCTCTGGGAAGATCCTATTCCTGCTCCCACATACGCTC
TGATTGACAACGGCGACATCATTGCCCTGAAGAACGAGATTCTCTCTGCCGGTATTGAGCCCACCAAATTGATTGCCACCGCCTGGGCATCGGCGTCTACCTTCCGCGGGGGTGACAAGC
GTGGAGGCGCCAACGGCGCCCACATCCGTCTCGCTCCCCAGAAGGACTGGGATGTCAACAACCCAGCCCAGTTGCAAGAAGTCCTAGGTCTGTTGGAGAGCATCCAAGGCCGCTTCAACA
AGGCCCAGAACGGCGAAAAGCGCGTCTCCATTGCCGATCTGATTGTGCTTGCTGGATCTGCTGCCCTCGAAAGAGCCGCGGGTATCCCCGTTCCTTTCACCCCTGGCCGCAACGATGCCA
CCCAGGAGCAAACAGATGTCGAGTCATTCGGCTGGCTCCGGCCCTTCGCCGATGGTTTCCGCAACTACGGCAACTCGACTCGCCGTGTCCGCACCGAACAGCTCCTCATCGACAAGGCGC
AGCAGCTGACCCTCTCTGCTCCTGAACTGACCGTCCTGCTTGGTGGTCTGCGTTCTCTGAACGCCAACTGGGATGGATCAAGAGACGGTGTCTTCACCTCCCGCCCTGGCCAGCTGAGCA
ACGACTTCTTCGTCAACTTGCTCGACATGAGCACTGTCTGGAAGCCAACCGACGCTGACAGTGAGAAGTTCGAAGGTTTCGACCGCAAGACTGGCGCCAAGAAGTGGTCTGCTACCCGTG
TTGACCTGATCTTCGGTCACCACGCTGAGCTCCGTGCTCTTTCTGAGCTGTACGCTAGCTCCGATGCCCAAGACAAGTTCAAGAAGGACTTTGTTGCTGCCTGGGACAAGGTTATGAATA
TGGACCGTTATGATATCCCCTGTTTCCCCGCGACCGGTCGTCCTCGCCTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGAATGTCCTGTTGCGCACAAGAGAAGCAATGTTGCTGGAGGTGGCACCCGCAACACCGACTGGTGGCCCAATTCCTTGAAGTTGGGTATTCTCCGCCAGCATACTGATGCCACC
AACCCTCAAACTAAGGACTTTGATTATGCCGCTGCCTTCAAGACCCTCGATTACTGGGGCCTCAAGAAGGATCTTCACGCCCTTATGACCGACTCTCAGGAGTTTTGGCCCGCTGATTTT
GGCCACTATGGTGGCCTTTTCATCCGAATGGCCTGGCACAGCGCTGGAACATACAGAGTCTTCGATGGACGCGGTGGCGGTGGCCAGGGCCAGCAGCGTTTTGCACCATTGAACTCTTGG
CCCGATAATGTCTCCCTTG
ATAAGGCCCGCCGACTACTTTGGCCCATCAAGCAGAAGTACGGCAACAAAATCTCCTGGGCAGATCTTCTGCTTCTAACTGGAAACGTTGCCTTGGAGTCT
ATGGGTTTCAAGACATTCGGATTTGCTGGAGGTCGCCCCGACGTCTGGGAAGCCGATGAGTCGGTGTACTGGGGAAGCGAGAACGTCTGGTTTACTAATAAGGCTCGTTATGAGGCCGAG
ACCGCAGAGGAGGAGGCTAAGCAGGGCAACATCAAGACTCGCGATCTCGAGGACCCACTGGCCGCGGTCGTCATGGGTTTGATTTATGTCAACCCTGAAGGTCCCGATGGAAACGGGGAC
CCTCTCTCTGCTGCCAGAGATATCCGTATTACATTCGGCCGTATGGCTATGAATGACGAAGAGACCGTCGCCTTGATTGCTGGAGGCCACACCTTCGGAAAAACGCACGGTGCTGCCCCT
GCTGATAATGTCGGAACCGAGCCCGAAGCTGCTGGCATTGAATCGCAAGGCCTGGGATGGCACAACAAGCACGGCTCCGGTGTAGGCCCCCATGCTATCACCAGTGGGTTGGAGGTGACC
TGGACAAGTACCCCTACCAAGTGGAGCAACTCCTTCTTGGAATATCTGTTCAAGTTCGAGTGGGAGCAGACCAAGAGTCCCGCTGGCGCTACGCAGTGGGTGGCCAAGAATGCGGGCGAT
ATCGTCCCTGATGCCTTTGACTCAAGCAAGAAGCACAGGCCTCATATGCTGACTACCGATCTTTCTCTGCGTTACGATCCCGCTTACGAGAAGATCTCCCGTCGCTTCCTTGAGAACCCT
GATGAGTTTGCCGACGCATTCGCCCGTGCGTGGTTCAAGCTGCTCCACCGTGACATGGGTCCTCGCGCTCGCTGGCTGGGCCCTGAGATCCCAAAGGAGGTCTCTCTCTGGGAAGATCCT
ATTCCTGCTCCCACATACGCTCTGATTGACAACGGCGACATCATTGCCCTGAAGAACGAGATTCTCTCTGCCGGTATTGAGCCCACCAAATTGATTGCCACCGCCTGGGCATCGGCGTCT
ACCTTCCGCGGGGGTGACAAGCGTGGAGGCGCCAACGGCGCCCACATCCGTCTCGCTCCCCAGAAGGACTGGGATGTCAACAACCCAGCCCAGTTGCAAGAAGTCCTAGGTCTGTTGGAG
AGCATCCAAGGCCGCTTCAACAAGGCCCAGAACGGCGAAAAGCGCGTCTCCATTGCCGATCTGATTGTGCTTGCTGGATCTGCTGCCCTCGAAAGAGCCGCGGGTATCCCCGTTCCTTTC
ACCCCTGGCCGCAACGATGCCACCCAGGAGCAAACAGATGTCGAGTCATTCGGCTGGCTCCGGCCCTTCGCCGATGGTTTCCGCAACTACGGCAACTCGACTCGCCGTGTCCGCACCGAA
CAGCTCCTCATCGACAAGGCGCAGCAGCTGACCCTCTCTGCTCCTGAACTGACCGTCCTGCTTGGTGGTCTGCGTTCTCTGAACGCCAACTGGGATGGATCAAGAGACGGTGTCTTCACC
TCCCGCCCTGGCCAGCTGAGCAACGACTTCTTCGTCAACTTGCTCGACATGAGCACTGTCTGGAAGCCAACCGACGCTGACAGTGAGAAGTTCGAAGGTTTCGACCGCAAGACTGGCGCC
AAGAAGTGGTCTGCTACCCGTGTTGACCTGATCTTCGGTCACCACGCTGAGCTCCGTGCTCTTTCTGAGCTGTACGCTAGCTCCGATGCCCAAGACAAGTTCAAGAAGGACTTTGTTGCT
GCCTGGGACAAGGTTATGAATATGGACCGTTATGATATCCCCTGTTTCCCCGCGACCGGTCGTCCTCGCCTGTGA

Retrieve as FASTA