Entry information : VvPrx64 (GSVIVT01008763001)
Entry ID 6633
Creation 2009-03-19 (Christophe Dunand)
Last sequence changes 2012-01-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-07-02 (Qiang Li)
Peroxidase information: VvPrx64 (GSVIVT01008763001)
Name (synonym) VvPrx64 (GSVIVT01008763001)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Vitaceae Vitis
Organism Vitis vinifera (Grape)    [TaxId: 29760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VvPrx64
start..stop
S start..stop
CsPrx27 545 0 11..319 5..314
CpapPrx26 540 0 6..324 6..322
PtPrx65 540 0 12..324 7..317
NnPrx64 540 0 11..319 5..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1781693..1781908 216 N° 2 1781995..1782183 189 N° 3 1782324..1782486 163 N° 4 1782577..1782971 395
join(1781693..1781908,1781995..1782183,1782324..1782486,1782577..1782971)


exon

Literature and cross-references VvPrx64 (GSVIVT01008763001)
Protein ref. GenPept:   CAO61952 [Mismatch]
DNA ref. Phytozome 12:   chr18 (1781693..1782971)
Cluster/Prediction ref. UniGene:   Vvi.24169
Other ref. GenBank:   CAAP02000190.1 (73869..72594)
Protein sequence: VvPrx64 (GSVIVT01008763001)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (296)
PWM (Da):   %s   34365.47 (31709.0) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.9 (8.92) Peptide Signal:   %s   cut: 29 range:29-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGAxxANILGVLVLTLLVMFPVSSPVYALSLNYYDQTCPKAESTISDAVKKAMTNDKTVPAALLRMHFHDCFIRGCDASVLLKSVGKNTAEKDGPPNISLHAFYVIDNAKKAVEALCPGVVSCADILALAVRDAVALSGGPTWNVSKGRKDGRISKATETRQLPAPTFNISQLQQSFSQRGLSMEDLVALSGGHTLGFSHCSSFQNRIHNFNSTHDVDPSVHPSFAASLRSVCPLHNKVKNAGATMDSSSTTFDNTYYKLLLQGRSLFSSDQALLTTTKTKALVSQFASSKDEFEKAFVKSMIKMSSITGGQEVRLDCRxxVVR

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 18, 3 introns) and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGCANNNNNNGCTAATATACTCGGAGTGCTGGTTCTCACACTACTTGTCATGTTTCCAGTTTCTTCTCCAGTCTATGCACTGAGCTTAAACTACTATGATCAGACATGCCCCAAG
GCTGAGTCAACAATTTCGGATGCTGTCAAAAAGGCAATGACAAATGACAAAACAGTTCCAGCTGCCCTACTTCGAATGCACTTCCATGATTGCTTC
ATTAGAGTAAACATTTTCTGCTCT
TATCTTTCTGCCCTTATCCTTCTTCTATGTTGTTTGTAAACTTAGAACAACAATAAGCCTTTTTGCAGGGGTGTGATGCTTCTGTGCTGCTGAAGTCAGTGGGCAAGAACACAGCAGAAA
AAGATGGGCCTCCAAACATTTCATTGCATGCATTTTATGTTATTGACAATGCCAAAAAAGCAGTGGAAGCTCTCTGCCCTGGTGTCGTCTCTTGCGCTGATATCTTGGCTCTGGCTGTAA
GGGATGCAGTT
GCCCTGGTTAGTTAACAATCATAATTGTCATATAATAATGACAGTTATCGACTTTGGTTTAGATGATATTGGTCAAGTAGTTGAAGTACTGTTTGACTTGGTTATAACA
TTTTTGTTACATGTTTTTCTCTGGTGGAATATGTTAGTCTGGAGGCCCTACTTGGAATGTGTCAAAAGGGAGAAAAGATGGAAGGATCTCAAAGGCAACTGAGACCAGACAGTTACCAGC
TCCAACCTTCAACATATCTCAGTTGCAGCAAAGCTTCTCCCAGAGGGGACTTTCCATGGAAGATCTAGTGGCAC
TCTCAGGTAAAAACCAACACTAAATTTTGATTGTGTTTTGAGTTTT
TCAGTAGAATATATGGAGAGTCTGATTCTGATTCAAATCTGGGCATACAGGCGGTCACACTCTCGGATTCTCTCATTGTTCATCCTTCCAAAACAGAATCCACAACTTCAACTCCACCCA
CGACGTTGACCCATCCGTACACCCATCATTTGCAGCCAGCCTACGAAGCGTGTGCCCCCTTCACAACAAGGTGAAAAATGCAGGAGCCACCATGGATTCTTCCTCAACTACATTTGATAA
CACATACTACAAACTTCTCCTCCAGGGGAGGAGTCTGTTCTCTTCAGATCAGGCTCTACTCACTACTACAAAGACCAAAGCGTTGGTCTCTCAATTTGCTAGCTCCAAAGATGAGTTTGA
GAAGGCCTTTGTGAAGTCCATGATCAAGATGAGTAGCATCACTGGTGGACAAGAGGTAAGGCTAGACTGCAGGNNNNNN

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGCANNNNNNGCTAATATACTCGGAGTGCTGGTTCTCACACTACTTGTCATGTTTCCAGTTTCTTCTCCAGTCTATGCACTGAGCTTAAACTACTATGATCAGACATGCCCCAAG
GCTGAGTCAACAATTTCGGATGCTGTCAAAAAGGCAATGACAAATGACAAAACAGTTCCAGCTGCCCTACTTCGAATGCACTTCCATGATTGCTTC
TTGCAGGGGTGTGATGCTTCTGTG
CTGCTGAAGTCAGTGGGCAAGAACACAGCAGAAAAAGATGGGCCTCCAAACATTTCATTGCATGCATTTTATGTTATTGACAATGCCAAAAAAGCAGTGGAAGCTCTCTGCCCTGGTGTC
GTCTCTTGCGCTGATATCTTGGCTCTGGCTGTAAGGGATGCAGTT
TGTTAGTCTGGAGGCCCTACTTGGAATGTGTCAAAAGGGAGAAAAGATGGAAGGATCTCAAAGGCAACTGAGACC
AGACAGTTACCAGCTCCAACCTTCAACATATCTCAGTTGCAGCAAAGCTTCTCCCAGAGGGGACTTTCCATGGAAGATCTAGTGGCAC
ATACAGGCGGTCACACTCTCGGATTCTCTCAT
TGTTCATCCTTCCAAAACAGAATCCACAACTTCAACTCCACCCACGACGTTGACCCATCCGTACACCCATCATTTGCAGCCAGCCTACGAAGCGTGTGCCCCCTTCACAACAAGGTGAAA
AATGCAGGAGCCACCATGGATTCTTCCTCAACTACATTTGATAACACATACTACAAACTTCTCCTCCAGGGGAGGAGTCTGTTCTCTTCAGATCAGGCTCTACTCACTACTACAAAGACC
AAAGCGTTGGTCTCTCAATTTGCTAGCTCCAAAGATGAGTTTGAGAAGGCCTTTGTGAAGTCCATGATCAAGATGAGTAGCATCACTGGTGGACAAGAGGTAAGGCTAGACTGCAGGNNN
NNN

Retrieve as FASTA