Entry information : LbiLDS01
Entry ID 6641
Creation 2009-03-29 (Christophe Dunand)
Last sequence changes 2009-03-29 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: LbiLDS01
Name LbiLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue types Mycelium
Vegetative mycelia
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LbiLDS01
start..stop
S start..stop
CcinLDS01 1157 0 6..1073 4..1089
JargLDS01 1086 0 1..1071 1..1068
AbLDS01_burnettii 1072 0 9..1070 10..1082
AbLDS01_bisporus 1056 0 9..1070 10..1082
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 110616..110786 171 N° 2 110834..110896 63 N° 3 110947..111028 82 N° 4 111088..111647 560
N° 5 111697..111915 219 N° 6 111965..112129 165 N° 7 112180..112259 80 N° 8 112312..112480 169
N° 9 112537..112570 34 N° 10 112624..112667 44 N° 11 112718..112765 48 N° 12 112815..112953 139
N° 13 113008..113336 329 N° 14 113507..113725 219 N° 15 113750..113811 62 N° 16 113911..114031 121
N° 17 114090..114387 298 N° 18 114440..114558 119 N° 19 114614..114699 86 N° 20 114754..114781 28
N° 21 114836..114915 80 N° 22 114966..115056 91 N° 23 115111..115125 15  
join(110616..110786,110834..110896,110947..111028,111088..111647,111697..111915, 111965..112129,112180..112259,112312..112480,112537..112570,112624..112667,11271 8..112765,112815..112953,113008..113336,113507..113725,113750..113811,113911..11 4031,114090..114387,114440..114558,114614..114699,114754..114781,114836..114915, 114966..115056,115111..115125)


exon

Literature and cross-references LbiLDS01
Literature Peter,M., Deveau,A., Delaruelle,C., Kohler,A., Frey-Klett,P. and Martin,F.M. Analysis of expressed sequence tags of Laccaria bicolor S238N.
DNA ref. JGI genome:   scaffold_20 (110616..115125)
EST ref. GenBank:   EL739402 [3' end]
Protein sequence: LbiLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1073
PWM (Da):   %s   120076.83  
PI (pH):   %s   6.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLRYIRDRIVKRVDFIAESRAPLDTDGAHPQSHVFEKTVTEIHELLVKPAFQVSDLGAYWDAIQNLSTVGLNDRDLLLEKVLVLMSRLQHTKISLKVQQFVINLLYKDLPHPPSGYLGLSPSSTLCHHHKTLEDASTHALVKYAYRAADGSNYNPLFPTLGKAGSPYARSVPSANIVPSSALPDPELVFDTLLRRQKFVPHPGGISSLFFAFADLVIHSIFNTNHFDWSINDASSYLDLSVLYGSSESQVNSVRRRDGTGKLFDDVFADSRLLFMPPASCALLVLLNRNHYIAEKILNINENGNLSSPPPEDEKLRLAQDDEIFHRARLVNCGYFMHIILGDYVGAILGLVRDESDWRLDPLMTMREISHEFVPQGEGNVVSIEFNLLYRWHATLSAQDEKWTEGEFNKLFKGKNPNDVTIEDFKNAAHEFMLPPKDPRVWTFKDLKRDDKGRFNDADLAQILQDATEWRAGAYGARGTPEVLRVIEIMGMKQARSWGTCLNEFRKFLGLRPYETFAEWNPDREITAAAALYRDIDNLELHVGLQAEQTKKPGPGAGLCPGYTISRSILADAVCLTRGDRFLTVDFNPFNLTSWGYQDCQYDKKDGSYGGLLTKLLFRTLPEHYQRGSAYAHFPFLDPVFMREENLAKTNPSLVDKYIWTRPRQDSPTVPFDTLESVKKVLKDPHFVSAYDHRLYNVPEAIRHLHEGVSQVSSLIHGESTADWVAFFSKATEDLIKAKAFEPVSKGVKYVDIVKDVINILPIHWISHSILDLIGICSGWPTPEDERESRRYVYLNFDPVNDWHLRESSQRYSAEILDIIHAHIEKLTGILSIPDALNHLSIGASNKSHDFLKKVIDANGKNNTRHELAAQVFSATIPTAPLYSQAIAKVVDFYLAREQAVARQEIVNLANSKDKDAPSKILAYVREALRLNPTVAGVYRTAAQDVLVGSKRVNATEHAFASIVKANLPEVFGPHPSVASYSRPADKAGITTIGDFGLLSPVFFDTAPVILGKILSLKNLKPAPGKSGTLLSFKENWNGTPSTQYINTEGIVGPFPDSLLVFTPA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (20 introns) and 3 ESTs (EL739402, EX787091 and EX787090). Strain="S238N-H82".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCCTTCGGTATATTCGTGACCGGATCGTCAAGCGCGTTGACTTCATCGCCGAAAGTCGCGCTCCCCTCGACACTGATGGCGCGCATCCGCAAAGCCACGTTTTTGAAAAGACGGTG
ACAGAGATACACGAACTCCTCGTCAAACCCGCTTTTCAAGTTTCAGATCTA
GTGAGCCGTTAGCTTCTAGTCATTAACATTCGTCTAACGTTCGTCAGGGCGCGTACTGGGATGCGATTC
AAAATCTGAGCACTGTTGGCCTCAACGACCGGGACTTGCTG
GTGTGTAACCCATGCTCCTCGTCGATGAAAAAATTCTCACCATTGAGCAGCTTGAAAAAGTTCTCGTGTTGATGTCGAG
ACTTCAACACACCAAAATATCGCTGAAGGTCCAACAGTTCGTCATAAACCTCC
GTAAGCAGCGGCCTTCCTCTTTCGTCGGAGCGGAAGCTAATCTCTGATCGACTTGACAGTTTACAAG
GATCTGCCCCACCCACCAAGCGGCTATTTGGGCCTTTCTCCGTCATCTACCCTTTGCCATCACCACAAGACATTAGAAGACGCCTCCACACATGCCCTTGTGAAATATGCTTATCGCGCT
GCTGATGGATCAAACTACAATCCCCTCTTCCCCACACTCGGCAAAGCAGGGTCACCTTACGCCCGTTCCGTACCCTCCGCAAACATCGTGCCGAGTTCCGCCCTCCCTGATCCTGAACTG
GTCTTCGATACCCTCCTTCGACGCCAAAAGTTCGTCCCACACCCCGGAGGCATTTCTTCCCTATTCTTCGCGTTCGCGGATCTGGTGATCCACAGCATCTTCAACACCAACCACTTCGAC
TGGTCGATCAACGACGCAAGCAGTTACCTCGATCTTAGCGTACTCTACGGTAGCTCCGAGTCGCAAGTCAATTCAGTCAGGAGGAGAGATGGAACTGGAAAATTGTTCGATGATGTTTTC
GCGGATAGTCGTTTGCTATTCATGCCCCCAGCAAGCTGTGCGCTGTTGGTTTTGCTCAACAGGAATCATAAT
GTCTGTTCATCTTTGTTTCCACTGTTTATCTTCGCTGACGTTCTCCAA
GTACATTGCGGAGAAAATCTTGAATATCAATGAAAACGGCAATCTCAGCTCGCCGCCTCCCGAAGACGAAAAGTTACGGCTGGCGCAAGATGACGAAATCTTTCATCGAGCCCGCCTCGT
AAATTGTGGATATTTCATGCATATCATTCTCGGAGATTATGTAGGCGCAATCTTGGGGCTCGTCCGTGATGAATCCGACTGGCGTCTCGATCCCCTCATG
GTAAGTCCACCGATATATCG
TGTGCAACTTGCGCTAACCACTCCCCTAGACGATGCGTGAAATCAGTCACGAATTTGTCCCACAGGGTGAAGGCAACGTGGTTTCCATAGAGTTCAACCTCCTCTATAGGTGGCATGCAA
CGCTGTCTGCACAGGACGAGAAATGGACGGAAGGAGAGTTCAACAAGCTCTTCAAGGGCAAAAATCCCAACGAC
GTAGGTCTTTTGTTTATTTTGATCAGTGAGTGTCAATAACATTATT
CTAGGTTACCATTGAAGATTTCAAAAACGCGGCCCATGAATTTATGTTACCCCCGAAGGACCCCAGAGTCTGGACTTTCAAAGAGTATGTAACTTGCCCGTTGATCTTCAGCTTCTTTCA
ACAATTTTTATTTCAGTTTGAAGCGGGATGACAAGGGCCGTTTCAACGATGCCGACCTTGCACAGATTTTGCAAGATGCTACAGAATGGCGCGCAGGAGCATATGGAGCGCGAGGAACTC
CTGAAGTTCTCAGAGTGATTGAGATTATGGGGATGAAACAGGCGAGGTCTTGGGGAACTTGTTCG
GTATGTTGTGTTTATGAAGTTGTTGAGAGAAAGCTGACGTTGCTATCTCGTTCTA
GCTTAACGAGTTCAGGAAGTTTTTGGGGCTCAGGCGTCAGTCTGCTCCTCGTTCTTGGTATCTCTCCAAGCTGACTTGCCAATTTCAGCATACGAGACATTTGCAGAGTGGAATCCAGAT
CGTGAAATCCAT
GTAGGAGTGGTTTCTTCTCAGCTCCTCGCCGCATCTAACGTTGTTATCAGACCGCAGCGGCTGCATTGTACAGAGACATTGACAACTTGGAGCTCCACGTTAGTATCG
TCGATTTTCCTTGCCATATCACTCAACTCTCTATTCTAGGTCGGTCTGCAAGCAGAGCAAACTAAAAAGCCCGGGCCAGGAGCTGGCTTGTGCCCTGGTTACACCATCTCACGCTCCATT
CTTGCTGATGCAGTTTGCCTCACTCGAGGAGATCGTTTCTTGACTGTGGACTTCAATC
GTACGTTTCTCCCCCTTTTCAATACCAGTTTGATGTTGACCCTTGTTCGTGAAGCCTTCAAT
CTTACCTCTTGGGGATATCAAGACTGTCAATACGACAAGAAAGACGGTTCATACGGCGGTTTACTTACGAAGTTGCTTTTCCGCACATTGCCGGAGCACTACCAACGGGGATCAGCATAC
GCCCACTTCCCTTTCTTGGACCCCGTATTCATGAGAGAAGAAAACTTGGCGAAGACAAACCCATCTCTAGTCGACAAGTACATCTGGACTCGGCCGCGCCAGGATTCACCCACCGTTCCT
TTCGACACTCTTGAGAGTGTCAAGAAAGTTCTAAAGGACCCTCACTTTGTGTCTGCCTACGACCATCGACTTTATAACGTA
GTGAAACCTTTCCTGCCAAAGAAACGCCCATCAGCATTC
ACGACCGTGTCGAAGAGATTGGTACGACATCTACCCGTTGCCCATGACCATTTTGATTATGTATTTATTATCAGAGCATTATCAAGAAGTCGACTCCGACGACAGCGGTCACGCCTACGA
AAGAAAACGAGGTTCCAGAAGCCATAAGGCATCTTCATGAAGGGGTCTCACAAGTCTCCAGCCTGATTCATGGAGAATCTACGGCCGACTGGGTGGCTTTCTTCAGCAAAGCGACCGAAG
ATTTAATCAAGGCAAAGGCGTTTGAACCCGTGTCGAAAGGCGTGAAATACGTAGATATCGTCAAGGACGTTATCAACATTTTGCCGATCCATTGGATATCACATAGCATT
GTTCGTTCCG
TTACCATCTTCTAGCTCGATCTCATCGGCATCTGTTCAGGCTGGCCTACCCCTGAAGACGAGCGCGAATCCCGGCGGTGTGTGGTACGAGCAGGACACTTACCACAAGTTCGCGGTCATA
GCGAGGTTTGTTTCAATTCTCTGCTTCGTCTTGAGTCTCAATGAACAACCTTTAGCTATGTTTACCTTAATTTCGACCCGGTCAACGATTGGCATCTACGAGAATCCTCTCAGCGGTATT
CTGCTGAGATCCTTGACATTATTCATGCCCACATCGAAAAGCTCACCGGTATCCAG
GTCGGTTCATCGCAATTAACCCTCCGCTCAGCGCTGACTGAGACTCCCGATGTACTAGCTCTCG
ATTCCGGACGCCTTGAATCACCTTAGTATTGGTGCTTCAAACAAGAGCCACGATTTCTTAAAGAAAGTCATTGACGCAAATGGGAAGAATAATACCCGGCATGAGTTGGCAGCACAAGTT
TTCTCGGCTACCATTCCCACTGCACCCCTCTATTCTCAAGCGATCGCAAAGGTTGTCGACTTTTATCTCGCCAGGGAGCAAGCAGTGGCGCGACAAGAAATCGTAAACCTGGCAAATTCC
AAAGATAAAGACGCCCCCTCCAAAATCCTGGCATATGTCCGTGAAGCATTGC
GTCAGAGGTTCCCCTGCCATACGCAAGTTTTTGAGACTGACCTTTCCTCTAGGATTAAACCCTACTGT
GGCAGGTGTTTACCGTACAGCCGCTCAGGATGTCCTTGTTGGCTCAAAGCGAGTTAATGCCACCGAGCACGCCTTTGCCAGCATCGTGAAGGCGAATTTAGAC
GTATGCGACATTTTTTC
TGACAGGTTGATTGTCTCGACTGACCGAGTCGTTTTAGCCCGAAGTTTTCGGTCCCCACCCATCTGTGGCTAGTTACTCTCGGCCAGCCGACAAGGCAGGCATAACGACTATTGGGGACT
TTGG
GTAAATTTTTAAAATTAACTAAATGATAACCCTCAACTCAACCATACGTACCAGATTGCTGTCGCCCGTCTTTTTTGACGCTGTAAGTCCACACTTCCGTTTATTTCCTTTCATCT
GGCTTACTATGCACATTCAGACCGCTCCAGTGATTCTTGGAAAAATCCTATCATTAAAGAACTTGAAACCAGCACCTGGAAAATCTGGTACCCTCCTCAGGTAAGAACAAATTGGTAAAT
CGTGACTGCTTTCCTTACTGTCGACTTCAGCTTCAAAGAAAATTGGAACGGTACCCCGAGCACGCAGTACATCAACACCGAGGGAATCGTTGGACCATTCCCGGACTCTCTGCTTGTTCA
A
GTGAGCTAGCATTCATTGACTCCGATCCACAAGCATTGACTATAATCTCTCCAGTTCACACCAGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCCTTCGGTATATTCGTGACCGGATCGTCAAGCGCGTTGACTTCATCGCCGAAAGTCGCGCTCCCCTCGACACTGATGGCGCGCATCCGCAAAGCCACGTTTTTGAAAAGACGGTG
ACAGAGATACACGAACTCCTCGTCAAACCCGCTTTTCAAGTTTCAGATCTA
GGCGCGTACTGGGATGCGATTCAAAATCTGAGCACTGTTGGCCTCAACGACCGGGACTTGCTGCTTGAA
AAAGTTCTCGTGTTGATGTCGAGACTTCAACACACCAAAATATCGCTGAAGGTCCAACAGTTCGTCATAAACCTCC
TTTACAAGGATCTGCCCCACCCACCAAGCGGCTATTTGGGCCTT
TCTCCGTCATCTACCCTTTGCCATCACCACAAGACATTAGAAGACGCCTCCACACATGCCCTTGTGAAATATGCTTATCGCGCTGCTGATGGATCAAACTACAATCCCCTCTTCCCCACA
CTCGGCAAAGCAGGGTCACCTTACGCCCGTTCCGTACCCTCCGCAAACATCGTGCCGAGTTCCGCCCTCCCTGATCCTGAACTGGTCTTCGATACCCTCCTTCGACGCCAAAAGTTCGTC
CCACACCCCGGAGGCATTTCTTCCCTATTCTTCGCGTTCGCGGATCTGGTGATCCACAGCATCTTCAACACCAACCACTTCGACTGGTCGATCAACGACGCAAGCAGTTACCTCGATCTT
AGCGTACTCTACGGTAGCTCCGAGTCGCAAGTCAATTCAGTCAGGAGGAGAGATGGAACTGGAAAATTGTTCGATGATGTTTTCGCGGATAGTCGTTTGCTATTCATGCCCCCAGCAAGC
TGTGCGCTGTTGGTTTTGCTCAACAGGAATCATAAT
TACATTGCGGAGAAAATCTTGAATATCAATGAAAACGGCAATCTCAGCTCGCCGCCTCCCGAAGACGAAAAGTTACGGCTGGCG
CAAGATGACGAAATCTTTCATCGAGCCCGCCTCGTAAATTGTGGATATTTCATGCATATCATTCTCGGAGATTATGTAGGCGCAATCTTGGGGCTCGTCCGTGATGAATCCGACTGGCGT
CTCGATCCCCTCATG
ACGATGCGTGAAATCAGTCACGAATTTGTCCCACAGGGTGAAGGCAACGTGGTTTCCATAGAGTTCAACCTCCTCTATAGGTGGCATGCAACGCTGTCTGCACAG
GACGAGAAATGGACGGAAGGAGAGTTCAACAAGCTCTTCAAGGGCAAAAATCCCAACGAC
GTTACCATTGAAGATTTCAAAAACGCGGCCCATGAATTTATGTTACCCCCGAAGGACCCC
AGAGTCTGGACTTTCAAAGA
TTTGAAGCGGGATGACAAGGGCCGTTTCAACGATGCCGACCTTGCACAGATTTTGCAAGATGCTACAGAATGGCGCGCAGGAGCATATGGAGCGCGAGGA
ACTCCTGAAGTTCTCAGAGTGATTGAGATTATGGGGATGAAACAGGCGAGGTCTTGGGGAACTTGTTCG
CTTAACGAGTTCAGGAAGTTTTTGGGGCTCAGGCCATACGAGACATTTGCA
GAGTGGAATCCAGATCGTGAAATCCAT
ACCGCAGCGGCTGCATTGTACAGAGACATTGACAACTTGGAGCTCCACGTCGGTCTGCAAGCAGAGCAAACTAAAAAGCCCGGGCCAGGAGCT
GGCTTGTGCCCTGGTTACACCATCTCACGCTCCATTCTTGCTGATGCAGTTTGCCTCACTCGAGGAGATCGTTTCTTGACTGTGGACTTCAATC
CCTTCAATCTTACCTCTTGGGGATAT
CAAGACTGTCAATACGACAAGAAAGACGGTTCATACGGCGGTTTACTTACGAAGTTGCTTTTCCGCACATTGCCGGAGCACTACCAACGGGGATCAGCATACGCCCACTTCCCTTTCTTG
GACCCCGTATTCATGAGAGAAGAAAACTTGGCGAAGACAAACCCATCTCTAGTCGACAAGTACATCTGGACTCGGCCGCGCCAGGATTCACCCACCGTTCCTTTCGACACTCTTGAGAGT
GTCAAGAAAGTTCTAAAGGACCCTCACTTTGTGTCTGCCTACGACCATCGACTTTATAACGTA
GTTCCAGAAGCCATAAGGCATCTTCATGAAGGGGTCTCACAAGTCTCCAGCCTGATT
CATGGAGAATCTACGGCCGACTGGGTGGCTTTCTTCAGCAAAGCGACCGAAGATTTAATCAAGGCAAAGGCGTTTGAACCCGTGTCGAAAGGCGTGAAATACGTAGATATCGTCAAGGAC
GTTATCAACATTTTGCCGATCCATTGGATATCACATAGCATT
CTCGATCTCATCGGCATCTGTTCAGGCTGGCCTACCCCTGAAGACGAGCGCGAATCCCGGCGCTATGTTTACCTTAAT
TTCGACCCGGTCAACGATTGGCATCTACGAGAATCCTCTCAGCGGTATTCTGCTGAGATCCTTGACATTATTCATGCCCACATCGAAAAGCTCACCGGTATCCAG
CTCTCGATTCCGGAC
GCCTTGAATCACCTTAGTATTGGTGCTTCAAACAAGAGCCACGATTTCTTAAAGAAAGTCATTGACGCAAATGGGAAGAATAATACCCGGCATGAGTTGGCAGCACAAGTTTTCTCGGCT
ACCATTCCCACTGCACCCCTCTATTCTCAAGCGATCGCAAAGGTTGTCGACTTTTATCTCGCCAGGGAGCAAGCAGTGGCGCGACAAGAAATCGTAAACCTGGCAAATTCCAAAGATAAA
GACGCCCCCTCCAAAATCCTGGCATATGTCCGTGAAGCATTGC
GATTAAACCCTACTGTGGCAGGTGTTTACCGTACAGCCGCTCAGGATGTCCTTGTTGGCTCAAAGCGAGTTAATGCC
ACCGAGCACGCCTTTGCCAGCATCGTGAAGGCGAATTTAGAC
CCCGAAGTTTTCGGTCCCCACCCATCTGTGGCTAGTTACTCTCGGCCAGCCGACAAGGCAGGCATAACGACTATTGGG
GACTTTGG
ATTGCTGTCGCCCGTCTTTTTTGACGCTACCGCTCCAGTGATTCTTGGAAAAATCCTATCATTAAAGAACTTGAAACCAGCACCTGGAAAATCTGGTACCCTCCTCAGCTTC
AAAGAAAATTGGAACGGTACCCCGAGCACGCAGTACATCAACACCGAGGGAATCGTTGGACCATTCCCGGACTCTCTGCTTGTTCAA
TTCACACCAGCTTGA

Retrieve as FASTA