Entry information : PcLDS02
Entry ID 6647
Creation 2009-03-26 (Christophe Dunand)
Last sequence changes 2011-11-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PcLDS02
Name PcLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLDS02
start..stop
S start..stop
PplLDS02 949 0 1..634 8..687
JargLDS02 912 0 1..640 68..755
LbiLDS02 850 0 32..644 76..731
GluxLDS02 835 0 3..635 90..760
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 832436..832502 67 N° 2 832561..832772 212 N° 3 832832..832896 65 N° 4 832953..833169 217
N° 5 833224..833460 237 N° 6 833510..833572 63 N° 7 833624..833663 40 N° 8 833715..833919 205
N° 9 833974..834097 124 N° 10 834256..834367 112 N° 11 834426..834753 328 N° 12 834894..835158 265
join(832436..832502,832561..832772,832832..832896,832953..833169,833224..833460, 833510..833572,833624..833663,833715..833919,833974..834097,834256..834367,83442 6..834753,834894..835158)


exon

Literature and cross-references PcLDS02
Literature Martinez,D., Larrondo,L.F., Putnam,N., Sollewijn Gelpke,M.D., Huang,K., Chapman,J., Helfenbein,K.G., Ramaiya,P., Detter,J.C., Larimer,F., Coutinho,P.M., Henrissat,B., Berka,R., Cullen,D. and Rokhsar,D. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat. Biotechnol. 22 (6), 695-700 (2004)
DNA ref. JGI genome:   scaffold_3 (832436..835158)
Protein sequence: PcLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   644
PWM (Da):   %s   72569.04  
PI (pH):   %s   5.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLSKLPEGSFSTSLQNLVIEMLYNDLPHPPSTYVGKQYAWRTADGSYNNICDPDMGKAGTPYSRSVQQTHPLTRREMPDPGLIFDTLLRREFVKHPAGLSSMMFAFAALVIHTVFRTSHEDVTINETSSYVDLAPLYGCNQEAQDKIRVRDGRGLLYPDTFSEDRLMLLPPAVCVLLVLFSRNHYIARKLLEINERGTYTDPDLIPADDKDRMTKLLAQEEEIFQTARLINCAWFGSAIFSDYFSAILGLVRQGNSWSLNPFGEIRQEDHTLFERGRGNVCSVEFNCLYRWHATTSEYDEKWVEQLTAHLFGGRNPDDITPADLKQVLLKVQESEPDVTHWTFGNLKRQEDGTFKDEELAVILMTATEHPAGAFKARGTPGCMRLHEVMGIEAARRWGCCSLNDFRKIATTAERLYGDIDHLELYVGLQAEEAKPVMDGAGLCSYTVSRAILADAIALTRGDRFFTADYTPFNMTSWGFADCQRDANAPGYGSTLGRLFMRTLPNHYNADSTYTWFPLMTPDAMKTILAKLGDADIYNMARPSPEQHVTDVLEFFLASNDPATARKEQQAMLEALVGAPGAVDRITEFFYLKTREMMVSESWGSVKRTTKNVDIVRDVLKYVPLYWACEVVSAISLPLRA

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns). No EST. Strain="RP-78".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTGTCAAAGCTGCCCGAGGGCTCATTCTCGACATCGCTGCAGAACCTCGTTATCGAGATGCGTGAGTCCGAGCGGTCAAGTTTCTCCGGCGCATGGACGCTGACTTTGAATCTC
TCAAGTCTACAACGATCTCCCACACCCGCCAAGCACATATGTCGGGAAGCAGTACGCCTGGCGCACCGCCGATGGCTCCTACAACAACATCTGCGACCCGGACATGGGCAAGGCGGGCAC
TCCGTACTCGCGCAGCGTCCAGCAAACCCATCCGCTCACGCGCAGGGAAATGCCTGATCCGGGTCTCATCTTCGACACGCTCCTGCGCCGGGAGAAG
GTGATGTTCTCACAAACACGGTC
TAGTCCGGACAAGTATTGATATATGTGCGCCTGCAGTTTGTCAAGCACCCGGCCGGCCTGTCGAGCATGATGTTTGCGTTTGCCGCGTTAGTCATACACACGTACGCAGCCCATCACGCT
CTATGTGCGCGAAATCCTTACAAACCGCGCATCACAGGGTATTCCGCACTTCTCATGAAGATGTCACTATCAACGAGACGTCGTCCTATGTCGACCTCGCGCCGCTGTACGGATGCAACC
AGGAGGCGCAGGACAAGATCCGCGTCCGGGACGGCCGCGGGCTCCTCTACCCTGATACCTTCTCCGAGGACCGACTCATGCTACTGCCGCCCGCGGTGTGCGTGCTCCTGGTACTGTTCA
GCAGGAACCACAAC
GTCTGTCTGCCTTCTCGTCTGACGCGCACGACCTCTGACGTGATGATTCAACAGTACATTGCGCGCAAATTGCTCGAGATCAACGAACGGGGGACGTACACAGACC
CGGATCTGATCCCGGCGGACGACAAGGACCGCATGACGAAGCTGCTTGCGCAAGAAGAGGAGATCTTCCAGACTGCACGCCTTATCAACTGCGCCTGGTTTGGTTCGGCGATCTTCTCGG
ACTACTTCAGTGCAATCCTGGGTCTGGTTCGGCAGGGAAATAGCTGGAGCTTGAATCCGTTCGGG
GTGATTACCGACTGCTTCTCCTTGGGAACGAAGGCTGACAGGCTCGCAGGAAATC
CGTCAAGAGGACCACACTCTTTTTGAGCGAGGACGGGGCAACGTGTGCAGTGTTGAG
GTGAGTCTCTCATGGTATTCCGCCGAGCGACGCCCTCAAATTCTCGCCCAGTTCAACTGTCTC
TACCGCTGGCACGCCACGACCTCCGAAT
GTGAGCCCACAGGTTTCATCCAGACGTACAGTCCCACTGACGACGTACCAGACGACGAGAAATGGGTCGAGCAGCTGACCGCGCACCTCTTC
GGCGGTCGCAATCCCGACGACATCACTCCCGCCGACCTGAAGCAGGTCCTGCTCAAGGTCCAGGAGTCCGAGCCGGACGTCACGCATTGGACATTTGGCAACTTGAAGCGCCAGGAAGAC
GGCACGTTCAAGGACGAGGAGCTTGCGGTAATCCTGATGACTGC
GTGAGTCGTTGGATGCGTGCTCCATTGTTTCAGTGTATTCAAGGTGAACTGTAGGACGGAACATCCGGCTGGCGCT
TTCAAGGCCCGTGGAACACCTGGGTGTATGCGTCTCCATGAGGTGATGGGCATCGAGGCAGCGCGTCGCTGGGGTTGCTGCTCCTTGAACGACTTCAGAAAG
GTAAGCATAACAAATTTC
TATAGTGCTTCTCAGTTGCTCATATAATTTGTAGTTCTTGGGACTCAAGCGTATGTCATCTGCTCAGTACCTGGATAGTGTGGCATTGAGTTGCTTTAACAGCATATGCGTCGTTCCTGG
AGTGGAACTCGGACCCAGAGATCGCTACGACAGCTGAAAGGCTTTACGGGGATATCGACCATCTTGAGCTGTACGTTGGTCTCCAAGCCGAAGAAGCCAAGCCCGTCATGGACGGTGCTG
GACTCTGCCCCT
GTATGTCGAGGATATTTTCCTGCCCCCTGAATACTATGTACTCACTATGTTCACGCAGCGTACACCGTCAGCCGTGCCATCCTTGCAGACGCCATCGCACTCACGCGC
GGTGACCGCTTTTTCACCGCGGACTACACGCCGTTCAACATGACCTCGTGGGGCTTCGCGGACTGCCAGCGCGACGCGAACGCGCCGGGCTATGGCAGCACGCTCGGCCGCCTCTTCATG
CGCACGCTCCCGAACCACTACAATGCGGACAGCACGTATACGTGGTTCCCGCTCATGACGCCCGACGCCATGAAGACGATCCTCGCGAAGCTCGGCGACGCGGATATCTACAACATGGCG
CGCCCGAGCCCCGAGCAGCACGTTACCGACGTCTTGGA
GTATAGGGACGTCGGTCAGGTTCTTGATAGCAAGGGCTTCGTGCCGCTGTACCACGGCAGGGCCGCGCTCGTGATCAAGGGC
AGAGGGTGAGGTTTCCTCTGTGCAATTGTTCGATGTGGAAGCTTACCTTCGCTTTCAGATTCTTCCTTGCGTCTAACGATCCCGCTACCGCCCGCAAGGAGCAACAGGCGATGCTAGAGG
CACTCGTCGGCGCCCCAGGCGCCGTCGACAGGATCACGGAATTCTTCTACCTCAAGACGCGCGAGATGATGGTCAGCGAGTCCTGGGGATCTGTCAAGCGGACCACGAAGAACGTCGATA
TCGTGCGTGACGTGCTGAAGTACGTTCCGCTGTACTGGGCCTGCGAGGTGGTAAGTGCTATATCTCTGCCTTTGCGCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTGTCAAAGCTGCCCGAGGGCTCATTCTCGACATCGCTGCAGAACCTCGTTATCGAGATGCTCTACAACGATCTCCCACACCCGCCAAGCACATATGTCGGGAAGCAGTACGCC
TGGCGCACCGCCGATGGCTCCTACAACAACATCTGCGACCCGGACATGGGCAAGGCGGGCACTCCGTACTCGCGCAGCGTCCAGCAAACCCATCCGCTCACGCGCAGGGAAATGCCTGAT
CCGGGTCTCATCTTCGACACGCTCCTGCGCCGGGAGAAG
TTTGTCAAGCACCCGGCCGGCCTGTCGAGCATGATGTTTGCGTTTGCCGCGTTAGTCATACACACGGTATTCCGCACTTCT
CATGAAGATGTCACTATCAACGAGACGTCGTCCTATGTCGACCTCGCGCCGCTGTACGGATGCAACCAGGAGGCGCAGGACAAGATCCGCGTCCGGGACGGCCGCGGGCTCCTCTACCCT
GATACCTTCTCCGAGGACCGACTCATGCTACTGCCGCCCGCGGTGTGCGTGCTCCTGGTACTGTTCAGCAGGAACCACAAC
TACATTGCGCGCAAATTGCTCGAGATCAACGAACGGGGG
ACGTACACAGACCCGGATCTGATCCCGGCGGACGACAAGGACCGCATGACGAAGCTGCTTGCGCAAGAAGAGGAGATCTTCCAGACTGCACGCCTTATCAACTGCGCCTGGTTTGGTTCG
GCGATCTTCTCGGACTACTTCAGTGCAATCCTGGGTCTGGTTCGGCAGGGAAATAGCTGGAGCTTGAATCCGTTCGGG
GAAATCCGTCAAGAGGACCACACTCTTTTTGAGCGAGGACGG
GGCAACGTGTGCAGTGTTGAG
TTCAACTGTCTCTACCGCTGGCACGCCACGACCTCCGAATACGACGAGAAATGGGTCGAGCAGCTGACCGCGCACCTCTTCGGCGGTCGCAATCCCGAC
GACATCACTCCCGCCGACCTGAAGCAGGTCCTGCTCAAGGTCCAGGAGTCCGAGCCGGACGTCACGCATTGGACATTTGGCAACTTGAAGCGCCAGGAAGACGGCACGTTCAAGGACGAG
GAGCTTGCGGTAATCCTGATGACTGC
GACGGAACATCCGGCTGGCGCTTTCAAGGCCCGTGGAACACCTGGGTGTATGCGTCTCCATGAGGTGATGGGCATCGAGGCAGCGCGTCGCTGG
GGTTGCTGCTCCTTGAACGACTTCAGAAAG
ATCGCTACGACAGCTGAAAGGCTTTACGGGGATATCGACCATCTTGAGCTGTACGTTGGTCTCCAAGCCGAAGAAGCCAAGCCCGTCATG
GACGGTGCTGGACTCTGCCCCT
CGTACACCGTCAGCCGTGCCATCCTTGCAGACGCCATCGCACTCACGCGCGGTGACCGCTTTTTCACCGCGGACTACACGCCGTTCAACATGACCTCG
TGGGGCTTCGCGGACTGCCAGCGCGACGCGAACGCGCCGGGCTATGGCAGCACGCTCGGCCGCCTCTTCATGCGCACGCTCCCGAACCACTACAATGCGGACAGCACGTATACGTGGTTC
CCGCTCATGACGCCCGACGCCATGAAGACGATCCTCGCGAAGCTCGGCGACGCGGATATCTACAACATGGCGCGCCCGAGCCCCGAGCAGCACGTTACCGACGTCTTGGA
ATTCTTCCTT
GCGTCTAACGATCCCGCTACCGCCCGCAAGGAGCAACAGGCGATGCTAGAGGCACTCGTCGGCGCCCCAGGCGCCGTCGACAGGATCACGGAATTCTTCTACCTCAAGACGCGCGAGATG
ATGGTCAGCGAGTCCTGGGGATCTGTCAAGCGGACCACGAAGAACGTCGATATCGTGCGTGACGTGCTGAAGTACGTTCCGCTGTACTGGGCCTGCGAGGTGGTAAGTGCTATATCTCTG
CCTTTGCGCGCCTGA

Retrieve as FASTA