Entry information : PcLDS03
Entry ID 6648
Creation 2009-03-26 (Christophe Dunand)
Last sequence changes 2011-12-14 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: PcLDS03
Name PcLDS03
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLDS03
start..stop
S start..stop
PindLDS01 603 0 5..1003 72..1251
PindLDS02 594 0 127..1003 142..1098
AbLDS02_burnettii 571 0 127..1003 106..1032
LbiLDS02 566 0 138..1002 83..1018
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165164..165193 30 N° 2 165510..166058 549 N° 3 166120..166347 228 N° 4 166455..166576 122
N° 5 166742..166838 97 N° 6 166892..166942 51 N° 7 167023..167192 170 N° 8 167242..167675 434
N° 9 167727..167983 257 N° 10 168020..168102 83 N° 11 168157..168214 58 N° 12 168245..168364 120
N° 13 168468..168617 150 N° 14 168686..168980 295 N° 15 169057..169133 77 N° 16 169229..169510 282
N° 17 169567..169608 42  
join(165164..165193,165510..166058,166120..166347,166455..166576,166742..166838, 166892..166942,167023..167192,167242..167675,167727..167983,168020..168102,16815 7..168214,168245..168364,168468..168617,168686..168980,169057..169133,169229..16 9510,169567..169608)


exon

Literature and cross-references PcLDS03
Literature Martinez,D., Larrondo,L.F., Putnam,N., Sollewijn Gelpke,M.D., Huang,K., Chapman,J., Helfenbein,K.G., Ramaiya,P., Detter,J.C., Larimer,F., Coutinho,P.M., Henrissat,B., Berka,R., Cullen,D. and Rokhsar,D. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat. Biotechnol. 22 (6), 695-700 (2004)
DNA ref. JGI genome:   scaffold_18 (165164..169608)
Cluster/Prediction ref. JGI gene:   140491 [Incorrect prediction]
Protein sequence: PcLDS03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1014
PWM (Da):   %s   110869.57  
PI (pH):   %s   4.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIKDAITKFLESAFEVLEHPDAIDDRNGFFVDLLSALCKLPQDGDFAKEANDKVITLLYNSLPHPPAAYIGSDPSGSVPWTEANAVPRPTGSSSTPPSGAPSWSPPPANGGPSMPPNAPGQSGSAGPAPPPPPPRAPWAFRNADGSGNNAWQPALGQSGRPYARDVENKQPLPAHVLPDAGLVFDALLRSRGDFEPHPGRNSALTFAFASLVTHSLFRTAPTDPTVNNTTSYLDLSPLYGTNQAEQDLVRNKGAGRGLLWNDAFAEDRLYIANMLLKINERNRWQDPPPPDPVKRAQQDEEIFQVARLVNGGHFMGMIFGDYVGGFLGLPRDGLGWSMNPFPIKTPSGDFLGRGEGNHWHAVTAEKDIDWTKNLFAEIFPGKDPETLQLSDFGAAIGRSWSTLVDPNPRTRTFGGLKRGPDGSFADDDIANVLQTATETVAGAYRARGHPAVFRVVEVMSIMQGRAWGVCSMNEFRTFLGLKPFADFEEWNRDPEIAQAARQLYGHIDNLELYPGIQAEETMPLGPGSGICCGFTMTRAILGDAVALVRGDRFYTTDYPANLTTWGFQDCARDPNNGAFGAALPKLLMRHLPRHYPGDSVYSLFPFYTPEIMKTNLTGLGLADQYSGMDGARPKPLPVPAVVDTFALPARRDMRLLAQKFEPFMALGDEAKFAKNQAWLKQALFPEGARIAEGLLKDNSFVMDGIPGTRIDIVGNVINLVSVQFVADYLEIYDMLSLLYTATMMDVQPEHVWTLEHGAMQIVDTLEKIVTQNIKDASPAVLGFVSSFVWPAETHKPYHDFLARLQVGGRSVQDVVTQVLGLAVCGSMPFAQGVAQIVDFYMDDARAKERAEIARLAQEDSKDPEQQALLLGYIREAQLLREVKKADTIPLEDGKTLSVQPGDPEDFPDPLAVDPLRTADKYRLQGSGFHEYLGSDFSERTIAEVVKVVFRLKNLRRAEKPLGQLAGLSLDTYGTESPVFLDDTGNLSYWPGSMTLVYDPQGTVQSFRHM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns) and 3 ESTs (DV756780, DV763275 and DV760262). Strain="RP-78". Uncorrect prediction from JGI.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCAAGGATGCTATAACCAAGTTCCTGGTACGCCTCCCTGCTCCATGCACTGTGCTCTTGCTCACTTGCTATCTAGGCTGCGGTAGACGTAGTCGAGCTCGCAGAGAGGCCACTCCC
GACGGCCCCGGACGGCAAGTACTCGTATCAAGTGCAGCCAAAACAGACCGCTCCTCCACCGGGTCCGACTGCCGCAGACAAGGCGACGCACTCGTCACTGTCCATTCTCTGGCAGAAGCT
GCAGACACAACTCAAGCAGGGTCCCCTAGTTCCAGACCCACGCAAGTTCCTAGTGAGCAAAGCGTGTCCCATTTCTGAAGACCGACCACTAACGCGTTGACTGCAGGAATCGGCCTTCGA
GGTGCTCGAGCACCCCGACGCCATCGACGATCGCAACGGCTTCTTTGTCGACCTCCTCAGCGCGCTCTGCAAGCTCCCGCAGGACGGCGACTTTGCAAAGGAGGCGAACGACAAGGTCAT
CACCCTCCTCTACAACTCCCTCCCGCACCCGCCCGCGGCGTACATCGGCTCGGATCCCTCGGGCAGCGTGCCATGGACCGAGGCCAACGCAGTGCCTCGGCCCACTGGTTCATCCTCGAC
GCCCCCGTCTGGCGCACCGTCGTGGAGCCCGCCCCCGGCGAATGGCGGCCCGTCGATGCCGCCGAACGCACCCGGCCAGTCGGGCAGCGCGGGTCCGGCGCCGCCGCCGCCGCCGCCGCG
CGCACCGTGGGCCTTCCGCAATGCCGACGGGAGCGGCAACAACGCGTGGCAGCCTGCGCTCGGCCAGTCGGGGCGGCCGTACGCGCGGGACGTCGAGAACAAGCAGCCGCTGCCGGCGCA
CGTGCTGCCCGACGCGGGGCTCGTGTTCGACGCGCTGCTGCGCTCGCGGGGCGAC
GTGAGTGGCCCGCGCCCACACCGCGTCTGTTCGCGGCTCGCTGATCATTCTCGTTCTGCAGTTCG
AGCCGCACCCGGGGCGCAACTCGGCGCTGACGTTCGCGTTCGCGTCGCTCGTGACGCACTCGCTGTTCCGCACGGCGCCGACGGACCCGACGGTGAACAACACGACGTCGTACCTCGACC
TCTCGCCGCTCTACGGCACGAACCAGGCCGAGCAGGACCTCGTGCGCAACAAGGGCGCGGGCCGCGGGCTGCTCTGGAACGACGCCTTCGCGGAGGACCGCCTC
GTGCTCGTCCCGCCCG
CCGCGAGCGCGCTGCTCGTGATCTTCAGCAGGAACCACAACGTGGGTCGCACGGTTGAGATCCATCGTCAGTGCTGACCCGCGGGCTGCAGTACATCGCGAACATGCTCCTGAAGATCAA
CGAGCGCAACCGGTGGCAGGACCCGCCCCCGCCCGACCCTGTGAAGCGCGCGCAGCAGGACGAGGAGATCTTCCAGGTCGCACGTCTCGTCAA
GTACGTCCCTTGTTGACCGTTCCGTGC
TCCAAGCGGGCCATTGTTGGTCCGTATAGGCACTCCTTCCGGGCAAAGAGCCTGTACCTCAATGTGTGCGCTTTGGCAGCTTCCCAGCGAGATCCCTGGGTGATAGTCTTGTACTGACAC
GCGCTTTTCTCCCGCCAGTGGCGGCCACTTTATGGGAATGATCTTTGGCGACTACGTCGGCGGGTTCTTGGGCCTGCCGCGCGATGGGCTTGGGTGGAGCATGAACCCCTTCGACGTGCG
TCAGCATTCTCCTGCAGGGCACAGTCCAACTCATTTTGCGATTGCCAGCCAATCAAAACGCCGAGTGGCGATTTCCTGGGTCGCGGCGAGGGTAACCACGTCTCTGTCGAGTTCAACTTG
ATGTACCGCGTGCGTTCACTGTCCTTCGAACCTCCTGCCGCCGCTGACCCTCTGCACAGTGGCACGCGGTGACTGCTGAAAAAGACATTGACTGGACGAAGAACCTCTTCGCTGAGATCT
TCCCCGGCAAGGACCCTGAGACTCTCCAGCTCAGCGACTTTGGCGCCGCGATCGGACGCAGCTGGAGCACCCTAGTCGACCCGAACCCGCGGACGCGGACATTCGGCGG
GTACGTCTGCT
CGCGCGTGCGCTGGCCTCAGCTGACAGTAGCGTTGCAGCCTCAAGCGTGGGCCCGACGGCTCGTTCGCGGACGACGACATCGCAAACGTCCTGCAGACCGCGACCGAGACCGTCGCGGGC
GCGTACCGCGCGCGGGGCCACCCGGCGGTGTTCCGCGTCGTCGAGGTCATGAGCATCATGCAGGGGCGCGCGTGGGGCGTGTGCTCGATGAACGAGTTCCGCACGTTCCTCGGCCTGAAG
CCGTTCGCCGACTTCGAGGAGTGGAACCGGGACCCCGAGATTGCGCAGGCGGCGCGCCAGCTCTACGGGCACATCGACAACCTCGAGCTGTACCCCGGCATTCAGGCCGAGGAGACGATG
CCGCTCGGTCCCGGCAGCGGCATCTGCTGCGGCTTCACGATGACCCGCGCGATCCTGGGCGACGCCGTCGCGCTCGTGCGGGGCGACCGATTCTACACCACTGACTACACCC
GTAAGCCG
CCGTTGCACCCTTGCTGCACCTCGGGCGCTGACCGTGCTCCAGCTGCGAACCTCACGACCTGGGGCTTCCAGGACTGCGCGCGCGACCCGAACAACGGCGCGTTCGGCGCGGCGCTGCCG
AAGCTGCTCATGCGCCACCTCCCGCGGCACTACCCCGGCGACAGCGTGTACTCGCTCTTCCCGTTCTACACGCCCGAGATCATGAAGACGAACCTGACGGGCCTCGGGCTCGCGGACCAG
TACTCGGGCATGGATGGCGCGCGCCCGAAGCCGCTCCCCGTCCCGGCGGTCGTCGACACC
GTCCGCGGCCTCGCGCACGTCTTCGACGACCCGCAGACGTTTGCGCTCCCCGCAAGACGC
GACATGAGACTGCTCGCGCAGAAGTTCGAGCCCTTCATGGCGCTCGGCGACGAGGCAAA
GTGAGCCTTCTTTGCAGCATGGATGTGCACGAGGTCTGATTGCGCCTCCTGTAGGTTCGCA
AAGAACCAGGCATGGCTGAAGCAGGCCCTGTTCCCGGAGGGTGCCCGCTCC
GTCGACGGCTACGCGCGGGCGTATCGCGAGATCGCGGAGGGCCTGCTCAAGGATAACTCGTTTGTCATG
GACGGCATCCCCGGCACTCGCATCGACATCGTCGGGAACGTCATCAACCTCGTCAGCGTGCAGTTCGTCGCAGACTACCTG
GTACGTGGTCCCATCGGCCGCCTCCGCGCGTTGTCTGAC
ATCCAGGCAGATGGGCGTTCCGCTGAAGACGAAGGCAAACCCGAAGGGCCTGTTCACCCGGCAGGAGATCTACGACATGCTGTCGCTGCTCTACACTGCGACCATGATGGACGTGCAGCC
CGAGCACGTCTGGACGCTCGAGCACGGCGCGATGCAGATCGTCGACACGCTCGAGAAGATCGTGACGCAGAACATCAAGGATGCCTCTCCTGCG
GTACGTCTTCGCGTTTGAACACCCGG
GATATCAGCCTGACGCAGACCCTGCAGCACCCTGTCGCGCAGGTTCTCGGCTTTGTCTCGAGCTTCGTGTGGCCGGCCGAGACGCACAAGCCGTACCACGACTTCCTGGCGCGGCTCCAG
GTCGGGGGGCGCTCGGTGCAAGACGTCGTCACGCAGGTGCTTGGGCTCGCCGTCTGTGGATCTATGCCCTTCGCACAGGGTGTCGCGCAGATCGTCGATTTCTACATGGACGATGCGCGG
GCGAAGGAGCGCGCCGAGATCGCGCGCCTGGCACAGGAAGACAGCAAGGACCCCGAGCAGCAGGCGCTGCTGCTTGGCTACATTCGCGAGGCTCAGC
GTGCGTCTATCTCGTCCGGTGGG
CCGAACCCTCGAGACTGATTTCCTTGCAGGTCTGTGTCCACAAACACCCGCAGTCCTACGTGAAGTCAAGAAGGCGGATACCATCCCCCTCGAGGACGGCAAAACGCTTTCCGTGCAGCC
CGGCGACACG
GTCTTTGCCAGCATCAAAAACGCCCATCTGAACGTGCGTCTGCTCCCTGCGTATGCATGTATGCGCGCATATGTACTGAGCCCTTTTTTGCGCAGCCGGAGGACTTCCCG
GACCCGCTCGCCGTCGACCCGCTCCGGACTGCGGACAAGTACCGGCTCCAGGGCTCTGGCTTCCACGAGTACCTCGGCTCAGACTTCAGCGAGCGCACGATCGCCGAGGTTGTGAAGGTC
GTCTTCCGCCTGAAGAACCTCCGTCGTGCGGAAAAGCCGTTGGGGCAGCTTGCGGGCCTCTCGCTCGATACCTACGGCACCGAGAGCCCCGTTTTCCTGGACGACACTGGGAACCTGTCG
TATTGGCCTGGCTCGATGACCCTCGTG
GTACGTCTTCTAGCGAAGTGCAGACGGCACGCTAATGACGTACTCTTGGCTTGCAGTACGATCCTCAAGGGACAGTGCAATCGTTTCGACATA
TGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCAAGGATGCTATAACCAAGTTCCTGGAATCGGCCTTCGAGGTGCTCGAGCACCCCGACGCCATCGACGATCGCAACGGCTTCTTTGTCGACCTCCTCAGCGCGCTCTGCAAGCTC
CCGCAGGACGGCGACTTTGCAAAGGAGGCGAACGACAAGGTCATCACCCTCCTCTACAACTCCCTCCCGCACCCGCCCGCGGCGTACATCGGCTCGGATCCCTCGGGCAGCGTGCCATGG
ACCGAGGCCAACGCAGTGCCTCGGCCCACTGGTTCATCCTCGACGCCCCCGTCTGGCGCACCGTCGTGGAGCCCGCCCCCGGCGAATGGCGGCCCGTCGATGCCGCCGAACGCACCCGGC
CAGTCGGGCAGCGCGGGTCCGGCGCCGCCGCCGCCGCCGCCGCGCGCACCGTGGGCCTTCCGCAATGCCGACGGGAGCGGCAACAACGCGTGGCAGCCTGCGCTCGGCCAGTCGGGGCGG
CCGTACGCGCGGGACGTCGAGAACAAGCAGCCGCTGCCGGCGCACGTGCTGCCCGACGCGGGGCTCGTGTTCGACGCGCTGCTGCGCTCGCGGGGCGAC
TTCGAGCCGCACCCGGGGCGC
AACTCGGCGCTGACGTTCGCGTTCGCGTCGCTCGTGACGCACTCGCTGTTCCGCACGGCGCCGACGGACCCGACGGTGAACAACACGACGTCGTACCTCGACCTCTCGCCGCTCTACGGC
ACGAACCAGGCCGAGCAGGACCTCGTGCGCAACAAGGGCGCGGGCCGCGGGCTGCTCTGGAACGACGCCTTCGCGGAGGACCGCCTC
TACATCGCGAACATGCTCCTGAAGATCAACGAG
CGCAACCGGTGGCAGGACCCGCCCCCGCCCGACCCTGTGAAGCGCGCGCAGCAGGACGAGGAGATCTTCCAGGTCGCACGTCTCGTCAA
TGGCGGCCACTTTATGGGAATGATCTTTGGC
GACTACGTCGGCGGGTTCTTGGGCCTGCCGCGCGATGGGCTTGGGTGGAGCATGAACCCCTTCGAC
CCAATCAAAACGCCGAGTGGCGATTTCCTGGGTCGCGGCGAGGGTAACCACTGG
CACGCGGTGACTGCTGAAAAAGACATTGACTGGACGAAGAACCTCTTCGCTGAGATCTTCCCCGGCAAGGACCCTGAGACTCTCCAGCTCAGCGACTTTGGCGCCGCGATCGGACGCAGC
TGGAGCACCCTAGTCGACCCGAACCCGCGGACGCGGACATTCGGCGG
CCTCAAGCGTGGGCCCGACGGCTCGTTCGCGGACGACGACATCGCAAACGTCCTGCAGACCGCGACCGAGACC
GTCGCGGGCGCGTACCGCGCGCGGGGCCACCCGGCGGTGTTCCGCGTCGTCGAGGTCATGAGCATCATGCAGGGGCGCGCGTGGGGCGTGTGCTCGATGAACGAGTTCCGCACGTTCCTC
GGCCTGAAGCCGTTCGCCGACTTCGAGGAGTGGAACCGGGACCCCGAGATTGCGCAGGCGGCGCGCCAGCTCTACGGGCACATCGACAACCTCGAGCTGTACCCCGGCATTCAGGCCGAG
GAGACGATGCCGCTCGGTCCCGGCAGCGGCATCTGCTGCGGCTTCACGATGACCCGCGCGATCCTGGGCGACGCCGTCGCGCTCGTGCGGGGCGACCGATTCTACACCACTGACTACACC
C
CTGCGAACCTCACGACCTGGGGCTTCCAGGACTGCGCGCGCGACCCGAACAACGGCGCGTTCGGCGCGGCGCTGCCGAAGCTGCTCATGCGCCACCTCCCGCGGCACTACCCCGGCGAC
AGCGTGTACTCGCTCTTCCCGTTCTACACGCCCGAGATCATGAAGACGAACCTGACGGGCCTCGGGCTCGCGGACCAGTACTCGGGCATGGATGGCGCGCGCCCGAAGCCGCTCCCCGTC
CCGGCGGTCGTCGACACC
ACGTTTGCGCTCCCCGCAAGACGCGACATGAGACTGCTCGCGCAGAAGTTCGAGCCCTTCATGGCGCTCGGCGACGAGGCAAAGTTCGCAAAGAACCAGGCA
TGGCTGAAGCAGGCCCTGTTCCCGGAGGGTGCCCGCTCC
ATCGCGGAGGGCCTGCTCAAGGATAACTCGTTTGTCATGGACGGCATCCCCGGCACTCGCATCGACATCGTCGGGAACGTC
ATCAACCTCGTCAGCGTGCAGTTCGTCGCAGACTACCTG
GAGATCTACGACATGCTGTCGCTGCTCTACACTGCGACCATGATGGACGTGCAGCCCGAGCACGTCTGGACGCTCGAGCAC
GGCGCGATGCAGATCGTCGACACGCTCGAGAAGATCGTGACGCAGAACATCAAGGATGCCTCTCCTGCG
GTTCTCGGCTTTGTCTCGAGCTTCGTGTGGCCGGCCGAGACGCACAAGCCG
TACCACGACTTCCTGGCGCGGCTCCAGGTCGGGGGGCGCTCGGTGCAAGACGTCGTCACGCAGGTGCTTGGGCTCGCCGTCTGTGGATCTATGCCCTTCGCACAGGGTGTCGCGCAGATC
GTCGATTTCTACATGGACGATGCGCGGGCGAAGGAGCGCGCCGAGATCGCGCGCCTGGCACAGGAAGACAGCAAGGACCCCGAGCAGCAGGCGCTGCTGCTTGGCTACATTCGCGAGGCT
CAGC
TCCTACGTGAAGTCAAGAAGGCGGATACCATCCCCCTCGAGGACGGCAAAACGCTTTCCGTGCAGCCCGGCGACACGCCGGAGGACTTCCCGGACCCGCTCGCCGTCGACCCGCTC
CGGACTGCGGACAAGTACCGGCTCCAGGGCTCTGGCTTCCACGAGTACCTCGGCTCAGACTTCAGCGAGCGCACGATCGCCGAGGTTGTGAAGGTCGTCTTCCGCCTGAAGAACCTCCGT
CGTGCGGAAAAGCCGTTGGGGCAGCTTGCGGGCCTCTCGCTCGATACCTACGGCACCGAGAGCCCCGTTTTCCTGGACGACACTGGGAACCTGTCGTATTGGCCTGGCTCGATGACCCTC
GTG
TACGATCCTCAAGGGACAGTGCAATCGTTTCGACATATGTGA

Retrieve as FASTA