Entry information : PcLDS01
Entry ID 6649
Creation 2009-03-29 (Christophe Dunand)
Last sequence changes 2012-03-28 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-23 (Christophe Dunand)
Peroxidase information: PcLDS01
Name PcLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLDS01
start..stop
S start..stop
PplLDS01-1 877 0 61..1002 69..1004
PplLDS01-2 861 0 61..1003 69..1005
JargLDS01 796 0 21..928 19..933
LbiLDS01 784 0 21..802 20..820
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29258..29407 150 N° 2 29061..29208 148 N° 3 28745..29008 264 N° 4 28540..28695 156
N° 5 28377..28486 110 N° 6 27855..28321 467 N° 7 27767..27801 35 N° 8 27581..27714 134
N° 9 27462..27526 65 N° 10 27343..27376 34 N° 11 26611..27291 681 N° 12 26475..26560 86
N° 13 25924..26422 499 N° 14 25726..25805 80 N° 15 25576..25672 97 N° 16 25487..25507 21
complement(join(25487..25507,25576..25672,25726..25805,25924..26422,26475..26560 ,26611..27291,27343..27376,27462..27526,27581..27714,27767..27801,27855..28321,2 8377..28486,28540..28695,28745..29008,29061..29208,29258..29407))


exon

Literature and cross-references PcLDS01
Literature Martinez,D., Larrondo,L.F., Putnam,N., Sollewijn Gelpke,M.D., Huang,K., Chapman,J., Helfenbein,K.G., Ramaiya,P., Detter,J.C., Larimer,F., Coutinho,P.M., Henrissat,B., Berka,R., Cullen,D. and Rokhsar,D. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat. Biotechnol. 22 (6), 695-700 (2004)
DNA ref. JGI genome:   scaffold_31 (29407..25487)
Protein sequence: PcLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1008
PWM (Da):   %s   111499.22  
PI (pH):   %s   5.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGNMISEFKAELAERHTRLLSHTPPNEDGGRPHCHAPTDIVRDESAFRELINLCEDMRDALGGEGIDDRHLLLEKVLTWMATHSELDVEHRLESMVVEFLYKDLPHPPESYLSLPNEATHVPRSDVNYAFRPADGSNYNVMTPALGKAGTPYARSVPSARSLPASALPDASLVFDMLLKRDEFVPHPDGVSSLFFAFADLVIHSIFNTDRNDSTINNSSSYLDLSPLYGSSDKQVDTVRRKDGTGRLKEDVFADSRLLFMPPSACALLVLLCRNHYIADKMLAINEHGKFHAPETLEAPGRLAQDDELFARARLVNCGFFMQIILGDYVGAILGLARDGHAWRLKILEPYRSPTGGVVPRGEGNAVSAEFNLMYRWHATLSAPDTAWIEQEFRALFPGRDLATLTKEDFGRAYGHIRSRSAKEPQEWTFGGLKRGESGRYQVELAQILQNATEAEAGAFRARGIPEVMKVVELMAIEQARSWGTCLNEFRRFMGLKRKYIYVPYCGIFSEWNSDESVRAAQMLYHDIDNLELYVGLEAEEAKKPGPGAGLCPGYTLSRAILSDAVCLTRGDRFMTTDFTPQNLTAWGYNDCQFDVNDGSYGGMLTKLLFRTLPDCYPAGSVYAHFPFLVPKRMRKEFLSRDAALLDQYTWDRPVLPTSLLELPRPPPAYEARVRALTGRPATAFTGLEQVLFTPDALEAHRLSFLRFTDAQLHHQSLSIGGSKRYVDIVRDVVNMVPIFWIAAMIRPDATEAHDEGKHYRPDRYFQGFADLADYVYVNTDPSREFALRQRAQAVAASISKHVVGDAASLGMFDLISRIARRLQSALHTLEGSPLSPDGFVAQPPCAVPDVASFLPTLRLCGNSQGLASAFVGDLAASAAVLARCVARLVDRLLDGETHLRNELALAGLGVTDKQIAEQVYEAVRGMDDVGVEHGYVALTVPAMLHCIFSLPNLQRAPGPSGKLHRVVEGHDGAIVEVASYQNWKGEVTPWPSSLAVVVIDAT*

Retrieve as FASTA  
Remarks Complete sequence from genomic (17 introns) and 1 EST (DV759138). Strain="RP-78".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAACATGATTTCCGAGTTCAAGGCTGAGCTTGCTGAGAGGCACACCCGCCTCCTTTCCCACACACCGCCCAACGAGGACGGCGGCCGCCCTCATTGCCATGCGCCAACAGACATT
GTGCGCGACGAGTCGGCCTTCCGTGAGCTG
GTACGTCCGGACGGCCTCCACGGCTGCCACCCTCTAACAAGCCGGACAGATCAACCTCTGCGAAGATATGCGGGATGCCCTCGGTGGCGA
GGGCATCGACGACCGCCACCTGCTCCTCGAGAAGGTCCTCACCTGGATGGCGACGCACAGCGAACTGGACGTCGAGCACCGGCTCGAGAGCATGGTCGTCGAGTTCC
GTACGTCGACACC
TGCGCCGCATCTCTGCGCTCATACTCACTGCCCCCACAGTGTACAAGGACCTGCCACACCCGCCAGAGTCGTACCTCTCACTCCCGAACGAGGCTACGCACGTGCCCCGCTCAGATGTCA
ACTACGCCTTCCGCCCTGCGGACGGCTCGAATTACAACGTCATGACCCCTGCCCTCGGCAAGGCGGGCACGCCCTACGCACGGTCAGTACCCTCGGCACGCTCGCTCCCAGCGTCCGCGC
TGCCCGACGCAAGTCTCGTCTTCGACATGCTCCTCAAGCGCGACGAGTTTGTGCCGCACCCAG
GTACGCATCAACAATTTGGCGTCCCCACAGATTCTCACCGCGCCCCCAGACGGCGTT
TCAAGCCTGTTCTTCGCATTTGCGGACCTCGTCATCCACTCGATCTTCAACACGGACCGCAACGACTCGACGATCAACAACTCGAGCAGCTACCTCGACCTCAGCCCGCTCTACGGCAGC
TCGGACAAGCAGGTTGACACCGTTCGAC
GTGAGTTTCCGCACAGCCCGGTGGCATTAGCGCTAACTGGATTGATTTTGCAGGCAAGGACGGCACGGGCCGCCTGAAGGAGGATGTCTTCG
CGGACAGCCGGCTGCTGTTCATGCCGCCCTCGGCGTGCGCACTACTCGTGCTGCTCTGCCGGAACCATAAC
GTGCGTGTCCCAACTATTTCCTCGCTCACGTTCCACCTGCCAACGCTGC
GCGCAGTATATCGCCGACAAGATGCTCGCGATCAACGAGCACGGGAAGTTCCACGCGCCCGAGACACTCGAAGCCCCGGGACGACTGGCGCAGGACGACGAGCTCTTCGCGCGCGCGCGC
CTCGTGAACTGCGGGTTCTTCATGCAGATCATTCTCGGCGACTATGTCGGCGCGATTCTCGGGCTCGCGCGCGACGGGCACGCATGGCGGCTCAAGATCCTCGAGCCGTACCGCAGCCCG
ACCGGCGGCGTCGTCCCGCGCGGCGAGGGCAACGCCGTCTCGGCCGAGTTCAACCTCATGTACCGCTGGCACGCGACGCTCTCCGCGCCCGACACGGCGTGGATCGAGCAGGAGTTCCGC
GCGCTGTTCCCCGGCCGCGACCTCGCGACGCTCACGAAGGAGGACTTTGGCAGGGCGTACGGCCACATACGTTCCCGCTCCGCCAAGGAGCCGCAGGAGTGGACCTTTGGAGG
GTGCGTC
CCTCGGCATGGTGCCGCTGCGAGCTCGGGTCTGACAATGTCTGCAGCCTTAAGCGCGGCGAGTCGGGACGCTACCAGGACGGTAAGTCGTATCTCTCCAAACCCGTGCATCGCCGATGCT
GACATCGCCGTAGTGGAGCTTGCACAGATTCTGCAGAACGCCACCGAGGCCGAGGCCGGCGCTTTCCGCGCTCGCGGCATTCCTGAGGTCATGAAGGTCGTCGAGCTCATGGCAATCGAG
CAGGCGAGGAGCTGGGGCACATGCTCA
GTAAGCAAAATATACACCCCTCACAATGATCTACCCGCTAACGTTCGAGCATAGCTCAACGAGTTCAGGCGGTTCATGGGTCTCAAGCGTAAG
TACATTTATGTCCCTTACTGCGGGAT
GTGGTGCTGATGCAACTATCTGCAGCATATGCTAGGTCGGACCGTACCATAATCTCAGTTATTCCACTGCTGACTGTTGTCACAGCTTCTCTGA
GTGGAACTCGGACGAAAGCGTTGCT
GTGCGTAGTCTCGGAGCTATTAAACATTCCTTCCTCTGATACCTGTCGCAGAGGGCCGCGCAGATGCTATACCACGACATTGACAACCTGGAGCT
TTACGTTGGCTTGGAGGCCGAGGAGGCCAAGAAGCCCGGCCCCGGCGCGGGCCTGTGTCCTGGCTACACGCTCTCGCGCGCCATTCTCTCCGACGCCGTCTGCCTCACGCGCGGCGACCG
GTTCATGACGACCGATTTCACACCGCAGAACCTGACAGCCTGGGGCTACAACGACTGCCAGTTCGACGTCAACGACGGCTCGTACGGCGGCATGCTCACGAAGCTCCTCTTCCGCACCCT
GCCGGACTGCTACCCGGCTGGCAGCGTGTATGCACACTTCCCGTTCCTCGTCCCGAAGCGCATGCGCAAGGAGTTCCTCTCCCGCGACGCCGCGCTCCTTGATCAGTACACGTGGGACCG
CCCCGTGCTGCCCACATCTCTCCTCGAGCTCCCGCGCCCGCCCCCTGCGTACGAGGCGCGCGTGCGTGCGCTCACGGGCCGCCCCGCCACTGCCTTCACTGGACTCGAGCAGGTTCTGTT
CACCCCCGACGCCCTTGAGGCGCACCGCCTCAGCTTCCTGCGCTTCACGGATGCACAGCTGCACCACCAGTCGCTCTCCATCGGCGGCAGCAAGCGGTACGTCGACATTGTCCGCGATGT
CGTCAACATGGTACCCATCTTCTGGATTGCCGCTATG
GTCACTATTCATACATTTTCAGCTTGATCGGTCTCTAATGAGCTTCGCAGATCCGGCCAGATGCTACGGAGGCGCATGACGAA
GGCAAGCACTACCGTCCCGACCGGTACTTCCAGGGCTTTGCCGACCTCGCCGA
GTACGTGTCCTTTGAGCTGACATCATTCGCGTGTCATTGAAATGTATCACAGCTACGTTTATGTCAA
CACCGACCCCAGCCGCGAGTTCGCGCTGCGGCAACGCGCCCAGGCCGTCGCAGCAAGCATCTCGAAGCACGTCGTCGGCGACGCTGCATCACTCGGGATGTTCGACCTCATCTCTCGCAT
CGCGCGCCGTCTCCAGTCTGCGCTCCACACCCTCGAGGGCTCGCCGCTGTCGCCGGACGGCTTCGTGGCGCAGCCGCCGTGCGCCGTCCCCGACGTCGCGTCTTTCCTTCCGACCCTCCG
GCTGTGCGGCAACTCCCAGGGCCTCGCCTCCGCCTTTGTCGGCGACCTGGCGGCGTCAGCGGCGGTGTTGGCGCGCTGCGTCGCGCGCCTCGTGGACCGCCTGCTCGACGGCGAGACGCA
CCTCCGCAACGAGCTTGCGCTGGCGGGCCTTGGCGTGACCGATAAGCAGATTGCGGAGCAGGTGTACGAGGCGGTTCGCGGCATGGACGATGTTGGCGTCGAGCATGGGTACGTCGCTCT
CATT
GTATTGATCACAGCGCCTGTCTAATGCGGGTCGCAACAGTCTCATGGATAAGCGTTTCATTGAGGCGGTAAGTCGTATGTAGTGAATTTTGCACGGCGTGTCTGACCAGCAGTTGC
AGACTGTACCCGCCATGCTGCATTGCATCTTCAGCCTGCCCAACCTCCAGCGCGCTCCTGGTCCGTCTGGTAAACTCCATCGGTTCGTGTCTTTGTGACTCTCCCTGTGCGTACATTCTG
AATTCTCCTGTGCAGAGTCGTTGAGGGGCATGACGGCGCGATCGTCGAGGTTGCCTCGTACCAAAACTGGAAGGGCGAGGTCACACCATGGCCCTCTTCCCTGGCTGTCGAGGTATGTCT
ATGTGCCCGTTACAAGGATTACGCCTGCTGATTTGACGTTCAGTACTCCGAACTCCTCAGGTTGTAATTGATGCAACGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAACATGATTTCCGAGTTCAAGGCTGAGCTTGCTGAGAGGCACACCCGCCTCCTTTCCCACACACCGCCCAACGAGGACGGCGGCCGCCCTCATTGCCATGCGCCAACAGACATT
GTGCGCGACGAGTCGGCCTTCCGTGAGCTG
ATCAACCTCTGCGAAGATATGCGGGATGCCCTCGGTGGCGAGGGCATCGACGACCGCCACCTGCTCCTCGAGAAGGTCCTCACCTGGATG
GCGACGCACAGCGAACTGGACGTCGAGCACCGGCTCGAGAGCATGGTCGTCGAGTTCC
TGTACAAGGACCTGCCACACCCGCCAGAGTCGTACCTCTCACTCCCGAACGAGGCTACGCAC
GTGCCCCGCTCAGATGTCAACTACGCCTTCCGCCCTGCGGACGGCTCGAATTACAACGTCATGACCCCTGCCCTCGGCAAGGCGGGCACGCCCTACGCACGGTCAGTACCCTCGGCACGC
TCGCTCCCAGCGTCCGCGCTGCCCGACGCAAGTCTCGTCTTCGACATGCTCCTCAAGCGCGACGAGTTTGTGCCGCACCCAG
ACGGCGTTTCAAGCCTGTTCTTCGCATTTGCGGACCTC
GTCATCCACTCGATCTTCAACACGGACCGCAACGACTCGACGATCAACAACTCGAGCAGCTACCTCGACCTCAGCCCGCTCTACGGCAGCTCGGACAAGCAGGTTGACACCGTTCGAC
GC
AAGGACGGCACGGGCCGCCTGAAGGAGGATGTCTTCGCGGACAGCCGGCTGCTGTTCATGCCGCCCTCGGCGTGCGCACTACTCGTGCTGCTCTGCCGGAACCATAAC
TATATCGCCGAC
AAGATGCTCGCGATCAACGAGCACGGGAAGTTCCACGCGCCCGAGACACTCGAAGCCCCGGGACGACTGGCGCAGGACGACGAGCTCTTCGCGCGCGCGCGCCTCGTGAACTGCGGGTTC
TTCATGCAGATCATTCTCGGCGACTATGTCGGCGCGATTCTCGGGCTCGCGCGCGACGGGCACGCATGGCGGCTCAAGATCCTCGAGCCGTACCGCAGCCCGACCGGCGGCGTCGTCCCG
CGCGGCGAGGGCAACGCCGTCTCGGCCGAGTTCAACCTCATGTACCGCTGGCACGCGACGCTCTCCGCGCCCGACACGGCGTGGATCGAGCAGGAGTTCCGCGCGCTGTTCCCCGGCCGC
GACCTCGCGACGCTCACGAAGGAGGACTTTGGCAGGGCGTACGGCCACATACGTTCCCGCTCCGCCAAGGAGCCGCAGGAGTGGACCTTTGGAGG
CCTTAAGCGCGGCGAGTCGGGACGC
TACCAGGACG
TGGAGCTTGCACAGATTCTGCAGAACGCCACCGAGGCCGAGGCCGGCGCTTTCCGCGCTCGCGGCATTCCTGAGGTCATGAAGGTCGTCGAGCTCATGGCAATCGAGCAG
GCGAGGAGCTGGGGCACATGCTCA
CTCAACGAGTTCAGGCGGTTCATGGGTCTCAAGCGTAAGTACATTTATGTCCCTTACTGCGGGATCTTCTCTGAGTGGAACTCGGACGAAAGCGTT
GCT
AGGGCCGCGCAGATGCTATACCACGACATTGACAACCTGGAGCTTTACGTTGGCTTGGAGGCCGAGGAGGCCAAGAAGCCCGGCCCCGGCGCGGGCCTGTGTCCTGGCTACACGCTC
TCGCGCGCCATTCTCTCCGACGCCGTCTGCCTCACGCGCGGCGACCGGTTCATGACGACCGATTTCACACCGCAGAACCTGACAGCCTGGGGCTACAACGACTGCCAGTTCGACGTCAAC
GACGGCTCGTACGGCGGCATGCTCACGAAGCTCCTCTTCCGCACCCTGCCGGACTGCTACCCGGCTGGCAGCGTGTATGCACACTTCCCGTTCCTCGTCCCGAAGCGCATGCGCAAGGAG
TTCCTCTCCCGCGACGCCGCGCTCCTTGATCAGTACACGTGGGACCGCCCCGTGCTGCCCACATCTCTCCTCGAGCTCCCGCGCCCGCCCCCTGCGTACGAGGCGCGCGTGCGTGCGCTC
ACGGGCCGCCCCGCCACTGCCTTCACTGGACTCGAGCAGGTTCTGTTCACCCCCGACGCCCTTGAGGCGCACCGCCTCAGCTTCCTGCGCTTCACGGATGCACAGCTGCACCACCAGTCG
CTCTCCATCGGCGGCAGCAAGCGGTACGTCGACATTGTCCGCGATGTCGTCAACATGGTACCCATCTTCTGGATTGCCGCTATG
ATCCGGCCAGATGCTACGGAGGCGCATGACGAAGGC
AAGCACTACCGTCCCGACCGGTACTTCCAGGGCTTTGCCGACCTCGCCGA
CTACGTTTATGTCAACACCGACCCCAGCCGCGAGTTCGCGCTGCGGCAACGCGCCCAGGCCGTCGCAGCA
AGCATCTCGAAGCACGTCGTCGGCGACGCTGCATCACTCGGGATGTTCGACCTCATCTCTCGCATCGCGCGCCGTCTCCAGTCTGCGCTCCACACCCTCGAGGGCTCGCCGCTGTCGCCG
GACGGCTTCGTGGCGCAGCCGCCGTGCGCCGTCCCCGACGTCGCGTCTTTCCTTCCGACCCTCCGGCTGTGCGGCAACTCCCAGGGCCTCGCCTCCGCCTTTGTCGGCGACCTGGCGGCG
TCAGCGGCGGTGTTGGCGCGCTGCGTCGCGCGCCTCGTGGACCGCCTGCTCGACGGCGAGACGCACCTCCGCAACGAGCTTGCGCTGGCGGGCCTTGGCGTGACCGATAAGCAGATTGCG
GAGCAGGTGTACGAGGCGGTTCGCGGCATGGACGATGTTGGCGTCGAGCATGGGTACGTCGCTCTCATT
ACTGTACCCGCCATGCTGCATTGCATCTTCAGCCTGCCCAACCTCCAGCGC
GCTCCTGGTCCGTCTGGTAAACTCCATCG
AGTCGTTGAGGGGCATGACGGCGCGATCGTCGAGGTTGCCTCGTACCAAAACTGGAAGGGCGAGGTCACACCATGGCCCTCTTCCCTGGCT
GTCGAG
GTTGTAATTGATGCAACGTAG

Retrieve as FASTA