Entry information : CcinLDS02
Entry ID 6652
Creation 2009-03-28 (Christophe Dunand)
Last sequence changes 2009-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinLDS02
Name CcinLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinLDS02
start..stop
S start..stop
LbiLDS02 1237 0 53..987 70..1018
AbLDS02_burnettii 1030 0 65..989 114..1033
AbLDS02_bisporus 1002 0 65..989 114..1020
GluxLDS02 999 0 64..987 124..1054
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1211519..1211575 57 N° 2 1211803..1211933 131 N° 3 1212165..1212231 67 N° 4 1212293..1212378 86
N° 5 1212428..1212446 19 N° 6 1212499..1212563 65 N° 7 1212627..1212843 217 N° 8 1212897..1213056 160
N° 9 1213110..1213186 77 N° 10 1213240..1213484 245 N° 11 1213539..1213601 63 N° 12 1213653..1213942 290
N° 13 1213997..1214420 424 N° 14 1214480..1215551 1072  
join(1211519..1211575,1211803..1211933,1212165..1212231,1212293..1212378,1212428 ..1212446,1212499..1212563,1212627..1212843,1212897..1213056,1213110..1213186,12 13240..1213484,1213539..1213601,1213653..1213942,1213997..1214420,1214480..12155 51)


exon

Literature and cross-references CcinLDS02
DNA ref. JGI genome:   Chr_7 (1211519..1215548)
EST ref. GenBank:   DR421404.1 [3' end]   DY848907.1 [Fragment]
Protein sequence: CcinLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   990
PWM (Da):   %s   111801.92  
PI (pH):   %s   7.58
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSSKVKRMSTLFRKKEKEHLEYRKYSRPHSKLAKVDNTAPSSRLLSWTSSGTRSRSTTGNSSNQFAWRTADGSCNNVDIPDMGAGTPYSRSVQQTVPLPKNQMPDAGLLFDTLLRREFVPHPGGLSSLMFAFATLVIHTVFRTSHRDWTINETSSYVDLAPLYGNNEDDQNRIRIRDGRGHLYPDVFAEDRLLLLPPAVCALLVLFSRNHYIATKLLEVNERGTFVDPSTLSMDDPKQKAKLMAQDEELFQTARLVNCGWFAMVVFSDYFSCILGLVRDGNSWSLTPFEIRMEDHTLFERGKGNSCSVEFNCLYRWHTTTSREDEKWTEGVFSQLFPGKPFEEVTIDDFKTTAHKLLTNRPPTTEWTFGGLKRQPDGRFRDEDLARIIQDATECEAAAFGARGTPAVMRLNEIMGIEQSRRWGVCSLNEFRKFLGLKPYETFLEWNSDPDVARTAELLYGDINKLELYVGLQAEEAKPLVDGAGLCGYTCSRAILSDAIALTRGDRFFTHDFTPFNLTAWGYQDCQRDPNAWGFGSTMARLFLRTLPEDFDEKSVYTFFPLMTPQSMKVHLTKLNQLDNYDLARPKRNPCPTIIRDYPSVVAILNEPLGFRSPYSQKTRKIINGPIKGFYPAEGPKEQDVVRKALSGSPEVVGKVGTYFYEQIKKTIDENSYTFVNGKKRGIDVVKKVINTVPTAWLGDLGGLHVKTSKDSAGNYTVDELFQQLSEIYSFIFLNVDPAKVMVLQEKVRKYLKVIIPDIKDNFTGSFSLTGLFNTVFKYKKPVHHEIISRLTENETLKNHDVLSNVILALVVVGNAEITLASTNILDYYLGSDKAADIGKLAAAGDVAGLKPYIYEALRAVPPFAGVYRVSTREQIFAGRKFAESERVFLDITAANNQSREESTKEILRAEGAFEYLGEELTVEILAQIIRAIFERPGLTRAPGHSGQMSRFKTDNRPECHHTYLHHGERVTEWPYTLSVLYDAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (13 introns) and 3 ESTs (DR421138.1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCAAGCAAGGTCAAGCGTATGTCCACTCTATTCCGCAAGAAGGAGAAGGAGGTGAGCACGCAAGGTTGGAGGTCTTTTGGCGCCAATACTCACCATCCCTCGTGCTGTTAGCCC
TCCACCAGCAACGGTGTTGTCACTAATGGTGCTGAGAAGAAAGACGAGGCCGCCTCGCCGACCTCCCCAACTTCTCCATTGTCACCTTCGCAGGAGGCCGAGGGTATGAAGACGATGAGG
AACTTCCGCGAGAGCGTGAAGAAGGGGAGCCCATTTGACTTCAGCACCTCGAGTATCGTAAGTACAGCCGTCCTCACTCAAAATTAGCAAAGGTTGACAACACGGCCCCGTCATCAAGGC
TGCTGTCCTGGACCTCATCAGGAACAAGGAGTCGATCGACGACAGGAAACTCTTC
GTGCGTACTCCGACCGACCTCCTTAGTCCCATATGTTCATGGTCCATCTCCCACAGCTTGAACAT
GCTCTTACCTTCATTTCTCGCCTGGAAGAAGGCCCTCTGGCTCGCACCTTGAAGAACAAGATCATCCAGCTGCGTAAGGCGCTCGCTTTCTGTCGAGCATAAACCCACAGTTGACTCTTC
CAAAAGTTTACAACGACCTTACGCATCCTGCTTCCACCAGTGTTAGTAACCAGTTTGCATGGAGAACCGCCGATGGTTCCTGCAATAATGTCGATATCCCTGACATGGGAAAGGTGCGCC
ACCAATCCAAGATATTTTTATCGAAAGGGGCTCACCGTTATCTATTGACCTCAGGCTGGAACTCCTTATTCTCGTTCTGTCCAGCAAACCGTACCCCTTCCGAAGAACCAAATGCCCGAT
GCAGGGCTTCTCTTCGACAC
GTGAGTACTTGCACCTGTCGAAACGTCCAGTTAGCTCAATGGTTTTTAGCCTCTTACGAAGAGAGAAGGTATGTAATAGGGGCATTTCTCCAGCCATCGT
GACACTAATGGGGCGTTTAGTTCGTCCCACACCCAGGTGGTCTCTCTTCTTTGATGTTTGCATTTGCCACTTTGGTCATCCATACGTATGTCACCCAGACCAGATGACCCTTTGCACAGA
CCATTCTAACCATACCACCTGTCACTAGCGTCTTCCGGACTTCACACCGCGATTGGACAATCAACGAGACCTCCTCCTACGTTGACCTGGCGCCGCTCTACGGCAACAACGAGGACGATC
AAAACCGCATTAGGATCCGGGATGGCCGAGGTCACCTCTACCCGGATGTCTTTGCTGAAGACCGTCTCTTGTTGCTTCCACCAGCTGTTTGCGCGCTCCTGGTTCTCTTCAGCCGGAATC
ACAAC
GTGAGTGGATCCCCGCTTCCTGGAGTGCCCAGCCCTTAACTTTATTCCTGCAGTACATCGCCACTAAGCTTTTGGAGGTCAATGAGCGAGGAACCTTCGTCGATCCCAGCACCTT
GTCAATGGACGATCCTAAGCAAAAGGCTAAGTTGATGGCTCAAGATGAAGAGTTGTTCCAGACAGCGCGTCTCGTGAACTGCGGCTGGTTCGCAATGG
GTGAGTTCGATGTTTTGCTTTG
CAAGGGCGGGGCCTCATTCTACGCTGTACAGTTGTCTTCTCCGACTACTTCTCTTGCATTCTGGGACTGGTCCGAGATGGCAATAGTTGGAGCTTGACTCCTTTCGATGTAAGCACGGAT
CTTTCCCCTGCTGTATGTCGGGGGTGCTGATTCTTCATTAGGAAATCCGTATGGAAGATCACACCTTGTTCGAACGTGGCAAGGGCAACTCCTGCAGTGTCGAGTTCAACTGTCTCTACC
GATGGCACACCACGACCAGCAGGGAGGACGAGAAGTGGACCGAAGGAGTGTTCAGTCAGCTCTTCCCTGGCAAGCCCTTCGAAGAGGTCACGATCGACGACTTCAAGACGACTGCCCACA
AGTTGCTCACGAACAGGCCACCTACCACCGAATGGACCTTCGGAGG
GTACGTCGTACTCCCAACCTCTGATACTTCTCTCATTAATATATACCTGTGTAGATTGAAGCGCCAGCCAGACG
GAAGATTCAGGGACGAGGATTTGGCCAGGATTATCCAAGACGC
GTGAGTTCAAACACTGAATTTCCTACCGACAAGTACTCACCTTCGACCCAGAACTGAATGCGAGGCGGCTGCATTTG
GTGCTCGCGGAACCCCAGCAGTCATGAGGCTCAATGAGATCATGGGTATTGAACAGAGTAGGCGATGGGGTGTATGCTCGCTCAACGAGTTCAGGAAGTTCTTGGGCTTGAAGCCTTACG
AGACCTTCCTCGAATGGAACTCTGATCCTGACGTCGCTCGAACTGCCGAACTTCTCTATGGAGACATCAACAAGCTCGAGCTCTACGTGGGCTTGCAAGCTGAGGAGGCCAAGCCTCTTG
TTGACGGTGCAGGTCTCTGCCCTG
GTGAGTACATTTTCCACGTAAACATTCGGACGTAGGTGCTGAGCCATATTCAAGGCTACACTTGCAGTCGTGCAATCCTCAGCGACGCCATTGCTT
TGACTCGTGGAGACCGATTCTTCACTCACGACTTCACCCCCTTCAACCTCACCGCCTGGGGCTACCAAGATTGCCAGCGCGATCCCAATGCCTGGGGTTTCGGTAGCACCATGGCCAGGC
TGTTCTTGCGAACTCTCCCTGAAGACTTTGACGAGAAGAGTGTCTACACTTTCTTCCCGTTGATGACTCCCCAGTCCATGAAGGTGCATCTCACCAAGCTCAACCAATTGGACAACTACG
ATTTGGCTCGACCCAAACGCAACCCTTGTCCCACAATCATCAGGGACTATCCCTCCGTCGTTGCGATCCTCAACGAGCCCCTTGGGTTCAGGAGCCCCTACAGCCAAAAGACAAGGAAGA
TCATCAACGGCCCTATCAAAGG
GTGAGCAACTCTTTCCGCATCTAAGTCTTGGGCCTCGCATTAACCTCCTGGATCCCTAGATTCTATCCCGCAGAAGGCCCGAAAGAGCAGGACGTGGT
TCGCAAGGCTCTCAGCGGATCTCCCGAGGTCGTCGGCAAAGTCGGTACCTACTTCTACGAGCAGATCAAGAAGACCATCGACGAGAACTCGTATACCTTTGTCAACGGCAAGAAGCGCGG
TATCGACGTGGTCAAGAAAGTCATCAACACGGTGCCCACCGCCTGGCTTGGGGACTTGGGTGGTCTCCATGTGAAGACCAGCAAAGACTCGGCCGGCAACTACACCGTCGATGAGCTCTT
CCAACAACTCTCCGAGATCTATTCCTTCATCTTCCTCAACGTCGACCCAGCCAAGGTCATGGTCCTCCAGGAGAAGGTTCGCAAGTACCTCAAGGTAATCATTCCCGACATCAAGGACAA
CTTCACGGGTAGCTTCTCCCTCACTGGTCTCTTCAACACCGTCTTCAAATACAAGAAGCCCGTCCACCACGAGATCATCAGTCGCCTCACGGAGAACGAAACTCTCAAGAACCACGACGT
CCTCTCTAACGTCATCCTCGCGCTCGTCGTTGTCGGTAATGCCGAAATCACCCTCGCGTCGACCAACATCCTCGACTATTATCTTGGAAGTGACAAGGCTGCCGATATTGGGAAACTCGC
TGCTGCTGGGGACGTTGCGGGCTTGAAGCCTTACATCTATGAGGCCTTGCGGGCTGTCCCTCCTTTCGCTGGTGTCTACCGCGTCTCGACTCGCGAACAGATCTTTGCTGGTCGCAAGTT
CGCCGAGAGCGAGCGTGTCTTCTTGGACATTACCGCTGCGAACAACCAGAGCCGTGAAGAGTCCACGAAGGAGATCCTCCGTGCTGAGGGTGCCTTCGAGTACCTTGGTGAAGAGTTGAC
CGTCGAAATCCTCGCTCAAATCATCCGCGCCATCTTCGAACGACCCGGCCTCACTCGCGCACCTGGCCACTCTGGGCAGATGTCCCGCTTCAAGACCGACAACCGACCTGAATGCCACCA
CACTTACCTCCACCACGGCGAACGGGTTACTGAATGGCCATATACTCTTTCCGTATTGTACGATGCTGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCAAGCAAGGTCAAGCGTATGTCCACTCTATTCCGCAAGAAGGAGAAGGAGCACCTCGAGTATCGTAAGTACAGCCGTCCTCACTCAAAATTAGCAAAGGTTGACAACACGGCC
CCGTCATCAAGGCTGCTGTCCTGGACCTCATCAGGAACAAGGAGTCGATCGACGACAGGAAACTCTTC
TAACCAGTTTGCATGGAGAACCGCCGATGGTTCCTGCAATAATGTCGATATC
CCTGACATGGGAAAG
GCTGGAACTCCTTATTCTCGTTCTGTCCAGCAAACCGTACCCCTTCCGAAGAACCAAATGCCCGATGCAGGGCTTCTCTTCGACACCCTCTTACGAAGAGAGAAG
TTCGTCCCACACCCAGGTGGTCTCTCTTCTTTGATGTTTGCATTTGCCACTTTGGTCATCCATACCGTCTTCCGGACTTCACACCGCGATTGGACAATCAACGAGACCTCCTCCTACGTT
GACCTGGCGCCGCTCTACGGCAACAACGAGGACGATCAAAACCGCATTAGGATCCGGGATGGCCGAGGTCACCTCTACCCGGATGTCTTTGCTGAAGACCGTCTCTTGTTGCTTCCACCA
GCTGTTTGCGCGCTCCTGGTTCTCTTCAGCCGGAATCACAAC
TACATCGCCACTAAGCTTTTGGAGGTCAATGAGCGAGGAACCTTCGTCGATCCCAGCACCTTGTCAATGGACGATCCT
AAGCAAAAGGCTAAGTTGATGGCTCAAGATGAAGAGTTGTTCCAGACAGCGCGTCTCGTGAACTGCGGCTGGTTCGCAATGG
TTGTCTTCTCCGACTACTTCTCTTGCATTCTGGGACTG
GTCCGAGATGGCAATAGTTGGAGCTTGACTCCTTTCGAT
GAAATCCGTATGGAAGATCACACCTTGTTCGAACGTGGCAAGGGCAACTCCTGCAGTGTCGAGTTCAACTGTCTCTACCGA
TGGCACACCACGACCAGCAGGGAGGACGAGAAGTGGACCGAAGGAGTGTTCAGTCAGCTCTTCCCTGGCAAGCCCTTCGAAGAGGTCACGATCGACGACTTCAAGACGACTGCCCACAAG
TTGCTCACGAACAGGCCACCTACCACCGAATGGACCTTCGGAGG
ATTGAAGCGCCAGCCAGACGGAAGATTCAGGGACGAGGATTTGGCCAGGATTATCCAAGACGCAACTGAATGCGAG
GCGGCTGCATTTGGTGCTCGCGGAACCCCAGCAGTCATGAGGCTCAATGAGATCATGGGTATTGAACAGAGTAGGCGATGGGGTGTATGCTCGCTCAACGAGTTCAGGAAGTTCTTGGGC
TTGAAGCCTTACGAGACCTTCCTCGAATGGAACTCTGATCCTGACGTCGCTCGAACTGCCGAACTTCTCTATGGAGACATCAACAAGCTCGAGCTCTACGTGGGCTTGCAAGCTGAGGAG
GCCAAGCCTCTTGTTGACGGTGCAGGTCTCTGCCCTG
GCTACACTTGCAGTCGTGCAATCCTCAGCGACGCCATTGCTTTGACTCGTGGAGACCGATTCTTCACTCACGACTTCACCCCC
TTCAACCTCACCGCCTGGGGCTACCAAGATTGCCAGCGCGATCCCAATGCCTGGGGTTTCGGTAGCACCATGGCCAGGCTGTTCTTGCGAACTCTCCCTGAAGACTTTGACGAGAAGAGT
GTCTACACTTTCTTCCCGTTGATGACTCCCCAGTCCATGAAGGTGCATCTCACCAAGCTCAACCAATTGGACAACTACGATTTGGCTCGACCCAAACGCAACCCTTGTCCCACAATCATC
AGGGACTATCCCTCCGTCGTTGCGATCCTCAACGAGCCCCTTGGGTTCAGGAGCCCCTACAGCCAAAAGACAAGGAAGATCATCAACGGCCCTATCAAAGG
ATTCTATCCCGCAGAAGGC
CCGAAAGAGCAGGACGTGGTTCGCAAGGCTCTCAGCGGATCTCCCGAGGTCGTCGGCAAAGTCGGTACCTACTTCTACGAGCAGATCAAGAAGACCATCGACGAGAACTCGTATACCTTT
GTCAACGGCAAGAAGCGCGGTATCGACGTGGTCAAGAAAGTCATCAACACGGTGCCCACCGCCTGGCTTGGGGACTTGGGTGGTCTCCATGTGAAGACCAGCAAAGACTCGGCCGGCAAC
TACACCGTCGATGAGCTCTTCCAACAACTCTCCGAGATCTATTCCTTCATCTTCCTCAACGTCGACCCAGCCAAGGTCATGGTCCTCCAGGAGAAGGTTCGCAAGTACCTCAAGGTAATC
ATTCCCGACATCAAGGACAACTTCACGGGTAGCTTCTCCCTCACTGGTCTCTTCAACACCGTCTTCAAATACAAGAAGCCCGTCCACCACGAGATCATCAGTCGCCTCACGGAGAACGAA
ACTCTCAAGAACCACGACGTCCTCTCTAACGTCATCCTCGCGCTCGTCGTTGTCGGTAATGCCGAAATCACCCTCGCGTCGACCAACATCCTCGACTATTATCTTGGAAGTGACAAGGCT
GCCGATATTGGGAAACTCGCTGCTGCTGGGGACGTTGCGGGCTTGAAGCCTTACATCTATGAGGCCTTGCGGGCTGTCCCTCCTTTCGCTGGTGTCTACCGCGTCTCGACTCGCGAACAG
ATCTTTGCTGGTCGCAAGTTCGCCGAGAGCGAGCGTGTCTTCTTGGACATTACCGCTGCGAACAACCAGAGCCGTGAAGAGTCCACGAAGGAGATCCTCCGTGCTGAGGGTGCCTTCGAG
TACCTTGGTGAAGAGTTGACCGTCGAAATCCTCGCTCAAATCATCCGCGCCATCTTCGAACGACCCGGCCTCACTCGCGCACCTGGCCACTCTGGGCAGATGTCCCGCTTCAAGACCGAC
AACCGACCTGAATGCCACCACACTTACCTCCACCACGGCGAACGGGTTACTGAATGGCCATATACTCTTTCCGTATTGTACGATGCTGCCTAA

Retrieve as FASTA