Entry information : LbiLDS02
Entry ID 6653
Creation 2009-03-28 (Christophe Dunand)
Last sequence changes 2009-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: LbiLDS02
Name LbiLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LbiLDS02
start..stop
S start..stop
CcinLDS02 1237 0 70..1018 53..987
AbLDS02_burnettii 1217 0 5..1018 4..1031
GluxLDS02 1190 0 3..1019 8..1055
AbLDS02_bisporus 1189 0 5..1018 4..1018
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1776372..1776422 51 N° 2 1776618..1776789 172 N° 3 1776995..1777077 83 N° 4 1777129..1777214 86
N° 5 1777268..1777286 19 N° 6 1777337..1777618 282 N° 7 1777671..1777907 237 N° 8 1777958..1778020 63
N° 9 1778072..1778253 182 N° 10 1778305..1778367 63 N° 11 1778421..1778464 44 N° 12 1778519..1778598 80
N° 13 1778654..1778669 16 N° 14 1778726..1778875 150 N° 15 1778928..1779345 418 N° 16 1779396..1779615 220
N° 17 1779676..1779761 86 N° 18 1779816..1779936 121 N° 19 1779990..1780158 169 N° 20 1780209..1780319 111
N° 21 1780378..1780407 30 N° 22 1780464..1780552 89 N° 23 1780607..1780714 108 N° 24 1780764..1780843 80
N° 25 1780898..1781000 103  
join(1776372..1776422,1776618..1776789,1776995..1777077,1777129..1777214,1777268 ..1777286,1777337..1777618,1777671..1777907,1777958..1778020,1778072..1778253,17 78305..1778367,1778421..1778464,1778519..1778598,1778654..1778669,1778726..17788 75,1778928..1779345,1779396..1779615,1779676..1779761,1779816..1779936,1779990.. 1780158,1780209..1780319,1780378..1780407,1780464..1780552,1780607..1780714,1780 764..1780843,1780898..1781000)


exon

Literature and cross-references LbiLDS02
DNA ref. JGI genome:   LG_10 (1776372..1781000)
EST ref. GenBank:   EX787689.1 [3' end]
Protein sequence: LbiLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1020
PWM (Da):   %s   113625.7  
PI (pH):   %s   7.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVNRLSSFLGRRPSASIKRGVPFSLETSSLVTMTPSSFRTHLITIYHSKAAILDLIRHKDAIDDRKLLVRILGTATSISNKYAWRTADGSYNNIDVPDMGAGTPYSRSVQQSNPLPKNQLPDPGLVFDTLLKREFVKHPGGLSSLMFSFAALVIHSVFRTSHRDININETSSYVDLAPLYGNNVEDQNRIRVRDGRGRLHPDVFAEDRLLLLPPQVCVLLVLFSRNHNYIVERLLEINERGTYVDPDQLSPDDPAQKAQLLAQEEELFQTGRLINCGWFGSVVFSDYFSCILGLVRDGNNWSLSPFGEIRKDDHSLFERGKGNVCSVEFNCLYRWHATTSLEDEAWVHKAFSQIFGGKPIDQITPEDFRNAAKRLEQVQPDVTHWTFGGLQRQENGRFKDSDLADVLKNATEHSAGAFRARGTAAMRLNEVMGIEQNRRWGVCSLNDFRYLGLKPYATFLEWNSDPEIADSAEKLYGDINFLELYVGLQAEEAKPLVEGAGLCPGYTISRAILSDAIALTRGDRYFTHDFTPFNLTAWGFADCQRDPNAFGFGSTLGRLFLRTLPNDYTENSVYTFFPLMTPESMKTNLTKLNLLDKYDLSRPQTRTPLKIVSDHTEVVKLLKDKESTSKPYAARVARVIKGKGFFPAEGGKEQEAVTTALSGSPELVDDIGKYFYETTKKLIVDNSFTLVGGKVAGVDLVKHVLRVVPVLWVATDAGIELKTKSHPHGPYTPSELFDVLGEIYAFVFLDVELAKVMVLQESIKSHVKKLLRLIKGGLDGGAGNLSIAGIVETVSSLFSKPKKSDHSVLMKRLHELGQSHDQLANTVLALMVGASVELSLSLTNMVNLYLGSDKQAQITALAKNPDSSLKGYVYEALRIDPPFEGVYRISTKDQTIAGQTVNKNDRIFVDIGTANLEKVFPHPVAVDISRSTKEALFAEGVFEYLGEHLTVKVMGEVLRAVFDLNNVSRAPGQSGVLKRFKVHTRPECRYGYLNHSQIAYEWPTSMAIQYSK

Retrieve as FASTA  
Remarks Complete sequence from genomic (25 introns) and 26 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGTGAACAGGCTTTCGTCTTTCCTGGGCCGTCGCCCTAGTGCATCAGTAAGTGACCATTTGCAAAAGCCTTCATATCCTAACGCCAACTGTAGACAACTGGTGTCGCGAATGGTA
CAGCGACAGAGACCTCTCCCACCAACGGTGCCTCGGGCGATCCCAAAATCTTGAAAGACTTCCGCGAGCAGGTATAGTGTTACGACTGCATGGGGATACTTCGTCGAGGCCTGAACTTTT
CTCTAGATCAAGAGAGGGGTGCCCTTCAGCCTAGAGACGTCTTCTCTGGTGACTATGACCCCCAGCAGTTTTCGTACCCATCTAATCACCATTTACCATTCAAAGGCCGCAATTCTCGAT
CTTATAAGGCATAAGGATGCGATTGATGACAGGAAATTGCTGGTCCGTATCCTTGGCA
GTTAGCGACGACGCACTATCCAATGACGCCACTCTCTTAGCTTGAGCACGCCCTCACGTTCG
TCTCTCGGTTGGAGGAGGGTGATCTCTCACGCAAACTGAAAAATGGGATCATTGAACTTTGTCAGTCATTCTATCTTCTTATTAGAAGCATTTTCTTACGTAGTTTTCGTGTAAAACAGT
GTACAATGACCTTACGCACCCAGCTGCGACCAGCATCAGCAATAAATATGCCTGGCGAACTGCAGACGGATCCTACAACAACATTGACGTTCCTGATATGGGCAAGGTATGAGCATCATA
CTTGATGGTTGAGCACTTCTCATCTTCGTTTTTCAAGGCTGGGACACCTTACTCTCGGTCGGTGCAGCAATCCAACCCTTTGCCTAAGAATCAATTGCCGGACCCTGGTCTCGTGTTCGA
TAC
GTTCGTGTCGTATTTGCATCTTGATGTTTTCGTTCTAATTCAGACTTAACTAGGCTTCTGAAGCGTGAAGGAGTACGCCTGCAGTTTCTTTCCCATAGTTTTACACTTAACCTCCTT
TTTAGTTTGTCAAGCACCCCGGCGGACTTTCCTCCCTCATGTTCTCGTTCGCTGCACTCGTCATTCACAGCGTTTTTCGGACTTCCCATCGTGACATCAATATCAATGAAACCTCTTCCT
ATGTTGACCTCGCTCCTCTTTACGGGAATAATGTTGAAGACCAGAATCGAATCCGGGTGCGCGATGGCCGTGGTCGTCTTCATCCTGATGTTTTCGCGGAGGACCGACTGCTCTTGCTCC
CTCCTCAAGTTTGCGTCCTCTTGGTACTCTTCAGTCGCAATCACAAC
GTAAGCCCGTTTACTCCTTACGTACTCCCATCCACCTCAATCCGCTTCTTAGTACATTGTGGAACGTCTTCTG
GAAATCAACGAACGAGGAACTTACGTTGATCCTGATCAACTTTCGCCCGATGATCCTGCTCAAAAAGCCCAGCTTCTGGCGCAGGAAGAAGAGCTTTTCCAGACTGGTCGGCTCATCAAT
TGTGGCTGGTTTGGTTCAGTCGTCTTCTCTGATTATTTCTCCTGCATCTTGGGACTTGTAAGGGACGGCAATAACTGGAGTTTGAGTCCCTTTGGA
GTTGGTATCATCTTTGACTCAGCC
TTTCCTTTGACTAACTCTTCCTTCAGGAAATCAGAAAAGACGATCATTCGCTTTTCGAGCGGGGTAAAGGTAACGTATGCAGTGTTGAGGTAATTCTTGAGCGTCTCCTACTCCAGTGTC
ATTTTGACTTTTGAAAATAGTTCAACTGCTTGTATCGCTGGCACGCGACCACTAGCTTAGAAGACGAGGCATGGGTCCACAAGGCTTTTTCCCAGATATTCGGAGGCAAGCCAATCGACC
AGATCACACCGGAAGATTTCAGGAATGCAGCAAAGAGGTTGGAGCAGGTCCAACCTGATGTCACTCACTGGACTTTCGGAGG
GTGATCTTATCTGTCTGTGTTGCATCCCATTTCACTGA
TTATATTCCTTAGCTTGCAGCGACAAGAAAATGGAAGGTTCAAGGACTCTGATCTCGCTGATGTTCTAAAAAACGCGTGAGTTTCCTTCTACCTTCACACTTGATACCTTTATGCTCATC
CCTACCTAGTACTGAACACTCTGCAGGTGCATTCCGAGCCCGCGGAACGCCTGGTGCGGTTTCCAACTCATTTCTATCAAGCGCTTAGGCTCACTCTATGTTGACAGCTGCCATGCGTTT
GAATGAAGTTATGGGTATTGAGCAAAACAGGCGATGGGGCGTGTGTTCTCTGAATGATTTCAGAAAG
GTCAGTGCTGCCTCGCCTTTGCCTCATTACAATTCATCTAATAATCGTCTCAT
AGTACCTGGGCCTTAAGCGTAAGCATGCAACGCGTTTGTTGACTTGGAGTTAATTGAATGTTTCTGCCTCACAGCCTATGCCACATTCCTTGAATGGAACTCGGACCCCGAGATTGCAGA
CAGTGCTGAAAAGCTCTACGGAGACATCAACTTCCTCGAGCTCTACGTCGGTTTACAGGCAGAGGAGGCCAAGCCTTTGGTTGAAGGTGCTGGTCTGTGCCCTG
GTAAGTTTCCCTTCTT
TCCACTTTTGCCTCCGATTTGCTCATAAACTTTAAGGTTACACTATCAGTCGTGCCATCCTCAGTGACGCTATCGCCCTCACTCGTGGCGACAGGTACTTCACTCACGACTTTACGCCTT
TCAATCTTACTGCCTGGGGATTCGCTGATTGTCAAAGAGATCCCAACGCTTTTGGATTTGGAAGCACACTCGGCAGGCTTTTCCTCCGCACTCTGCCAAATGACTACACTGAGAATAGTG
TCTACACGTTCTTCCCCTTGATGACACCCGAATCAATGAAAACTAACTTGACGAAGTTGAACCTGCTCGACAAATATGATCTGTCGAGGCCGCAAACGCGAACCCCGCTCAAAATTGTCA
GCGATCATACCGAGGTGGTGAAACTTTTGAAGGACAAAGAAAGTACTTCTAAACCATACGCTGCGAGGGTTGCCAGGGTAATTAAGGGTAAAGG
GTATGGATAGATCTTTCATCATGTTG
GCAAATTGCTCATCGTGAAACCAGATTTTTCCCTGCGGAGGGCGGTAAGGAACAAGAAGCGGTCACCACTGCCTTGAGTGGCTCACCGGAGTTGGTGGACGACATTGGCAAATACTTTTA
CGAGACAACAAAGAAGCTTATCGTCGACAACTCATTCACCCTCGTTGGCGGGAAGGTTGCTGGTGTCGATCTTGTGAAACACGTCCTCAGAGTTGTTCCCGTCCTATGGGTCGCCACCGA
TCTT
GTGAGCCTTGACATAAAAATCAGGTCACCCACATTTTTTTAACTAGACCATCATCTGTAGGCGGGCATAGAACTGAAAACCAAGAGCCACCCCCATGGACCTTACACACCTAGCGA
ACTCTTCGATGTTCTTGGCGAAATTTATGC
GTAAGCACAGTGGCATCTGTAGGTTTGCTAGAATGGCTCTGAACCCTCATCTAGATTTGTCTTCCTCGATGTAGAACTTGCGAAGGTTAT
GGTCTTACAAGAAAGTATCAAGTCCCATGTCAAGAAGTTGTTGCGCCTCATCAAGGGTGGCTTAGACGGGGGTGCTGGTAACAGG
GTATCTTGCCAATTTTACTTTTGGTGTTATCAGTG
GCTCATTGTTTTTTGAAGCTTTCAATTGCTGGCATCGTTGAGACCGTCTCGTCCCTATTCTCTAAACCCAAGAAGTCCGACCACTCCGTCTTGATGAAGCGACTTCACGAACTAGGGCAA
TCCCATGACCAGCTTGCCAACACTGTCCTCGCCCTAATGGTCGGAGCAAGTGTTGAGCTGTCCCTCA
GTATGAAAACACCCCCGGCGATGTTGAACTGTTACTGAAGAGTCATGCAGGTT
TGACAAACATGGTCAATTTGTACCTTGGGTCGGACAAGCAAGCACAGATTACTGCCCTCGCCAAGAACCCAGATTCTTCTTTGAAAGGTTACGTGTACGAAGCTCTTC
GTGAGTTAACAC
ACTAAATTTTCACGCCCGTTCGTTGGATGTTAACTTTGTTTCTAAGGAATTGACCCACCCTTCGAAGGTGTCTACCGTATGTTATGCTAAAGTTTTTACGCACAAAATAGCTATTTAACT
CATTTCAATCAGGCATCTCAACCAAGGATCAAACCATCGCTGGGCAAACCGTGAACAAGAATGACCGCATTTTTGTGGACATTGGCACGGCTAACCTAAACGTATGTTTTTTGCTCCCGA
GTTTCTATATATCTAATGTATCTCCCTACAAATAGGAGAAGGTGTTCCCCCACCCTGTAGCCGTGGACATCTCTCGTTCGACGAAAGAGGCTCTTTTCGCCGAGGGTGTGTTTGAGTATC
TTGGGGAACATTTGACTGTCAAG
GTAGGGAGTATTCCTCGGAAAAGTTCACAAAGCTAATCACAACCCCAAGGTAATGGGTGAGGTGTTACGCGCTGTCTTCGACCTCAACAACGTTTCG
CGAGCCCCTGGTCAATCGGGAGTGCTGAAACG
GTTCGTGGTCTTCCTGCTATTAGTGTCTCTTGCACTCACACTTGTCCTCTGCAGGTTTAAGGTGCACACCCGACCTGAATGTCGTTAC
GGATACCTCAACCACAGTCAAATTGCTTATGAATGGCCCACGTCGATGGCCATCCAATATTCAAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGTGAACAGGCTTTCGTCTTTCCTGGGCCGTCGCCCTAGTGCATCAATCAAGAGAGGGGTGCCCTTCAGCCTAGAGACGTCTTCTCTGGTGACTATGACCCCCAGCAGTTTTCGT
ACCCATCTAATCACCATTTACCATTCAAAGGCCGCAATTCTCGATCTTATAAGGCATAAGGATGCGATTGATGACAGGAAATTGCTGGTCCGTATCCTTGGCA
CTGCGACCAGCATCAGC
AATAAATATGCCTGGCGAACTGCAGACGGATCCTACAACAACATTGACGTTCCTGATATGGGCAAG
GCTGGGACACCTTACTCTCGGTCGGTGCAGCAATCCAACCCTTTGCCTAAGAAT
CAATTGCCGGACCCTGGTCTCGTGTTCGATAC
GCTTCTGAAGCGTGAAGGATTTGTCAAGCACCCCGGCGGACTTTCCTCCCTCATGTTCTCGTTCGCTGCACTCGTCATTCACAGCGTT
TTTCGGACTTCCCATCGTGACATCAATATCAATGAAACCTCTTCCTATGTTGACCTCGCTCCTCTTTACGGGAATAATGTTGAAGACCAGAATCGAATCCGGGTGCGCGATGGCCGTGGT
CGTCTTCATCCTGATGTTTTCGCGGAGGACCGACTGCTCTTGCTCCCTCCTCAAGTTTGCGTCCTCTTGGTACTCTTCAGTCGCAATCACAAC
TACATTGTGGAACGTCTTCTGGAAATC
AACGAACGAGGAACTTACGTTGATCCTGATCAACTTTCGCCCGATGATCCTGCTCAAAAAGCCCAGCTTCTGGCGCAGGAAGAAGAGCTTTTCCAGACTGGTCGGCTCATCAATTGTGGC
TGGTTTGGTTCAGTCGTCTTCTCTGATTATTTCTCCTGCATCTTGGGACTTGTAAGGGACGGCAATAACTGGAGTTTGAGTCCCTTTGGA
GAAATCAGAAAAGACGATCATTCGCTTTTC
GAGCGGGGTAAAGGTAACGTATGCAGTGTTGAG
TTCAACTGCTTGTATCGCTGGCACGCGACCACTAGCTTAGAAGACGAGGCATGGGTCCACAAGGCTTTTTCCCAGATATTCGGAGGC
AAGCCAATCGACCAGATCACACCGGAAGATTTCAGGAATGCAGCAAAGAGGTTGGAGCAGGTCCAACCTGATGTCACTCACTGGACTTTCGGAGG
CTTGCAGCGACAAGAAAATGGAAGG
TTCAAGGACTCTGATCTCGCTGATGTTCTAAAAAACGC
TACTGAACACTCTGCAGGTGCATTCCGAGCCCGCGGAACGCCTGCTGCCATGCGTTTGAATGAAGTTATGGGTATTGAGCAA
AACAGGCGATGGGGCGTGTGTTCTCTGAATGATTTCAGAAAG
TACCTGGGCCTTAAGCCCTATGCCACATTCCTTGAATGGAACTCGGACCCCGAGATTGCAGACAGTGCTGAAAAGCTC
TACGGAGACATCAACTTCCTCGAGCTCTACGTCGGTTTACAGGCAGAGGAGGCCAAGCCTTTGGTTGAAGGTGCTGGTCTGTGCCCTG
GTTACACTATCAGTCGTGCCATCCTCAGTGAC
GCTATCGCCCTCACTCGTGGCGACAGGTACTTCACTCACGACTTTACGCCTTTCAATCTTACTGCCTGGGGATTCGCTGATTGTCAAAGAGATCCCAACGCTTTTGGATTTGGAAGCACA
CTCGGCAGGCTTTTCCTCCGCACTCTGCCAAATGACTACACTGAGAATAGTGTCTACACGTTCTTCCCCTTGATGACACCCGAATCAATGAAAACTAACTTGACGAAGTTGAACCTGCTC
GACAAATATGATCTGTCGAGGCCGCAAACGCGAACCCCGCTCAAAATTGTCAGCGATCATACCGAGGTGGTGAAACTTTTGAAGGACAAAGAAAGTACTTCTAAACCATACGCTGCGAGG
GTTGCCAGGGTAATTAAGGGTAAAGG
ATTTTTCCCTGCGGAGGGCGGTAAGGAACAAGAAGCGGTCACCACTGCCTTGAGTGGCTCACCGGAGTTGGTGGACGACATTGGCAAATACTTT
TACGAGACAACAAAGAAGCTTATCGTCGACAACTCATTCACCCTCGTTGGCGGGAAGGTTGCTGGTGTCGATCTTGTGAAACACGTCCTCAGAGTTGTTCCCGTCCTATGGGTCGCCACC
GATCTT
GCGGGCATAGAACTGAAAACCAAGAGCCACCCCCATGGACCTTACACACCTAGCGAACTCTTCGATGTTCTTGGCGAAATTTATGCATTTGTCTTCCTCGATGTAGAACTTGCG
AAGGTTATGGTCTTACAAGAAAGTATCAAGTCCCATGTCAAGAAGTTGTTGCGCCTCATCAAGGGTGGCTTAGACGGGGGTGCTGGTAACAGG
CTTTCAATTGCTGGCATCGTTGAGACC
GTCTCGTCCCTATTCTCTAAACCCAAGAAGTCCGACCACTCCGTCTTGATGAAGCGACTTCACGAACTAGGGCAATCCCATGACCAGCTTGCCAACACTGTCCTCGCCCTAATGGTCGGA
GCAAGTGTTGAGCTGTCCCTCA
GTTTGACAAACATGGTCAATTTGTACCTTGGGTCGGACAAGCAAGCACAGATTACTGCCCTCGCCAAGAACCCAGATTCTTCTTTGAAAGGTTACGTG
TACGAAGCTCTTC
GAATTGACCCACCCTTCGAAGGTGTCTACCGCATCTCAACCAAGGATCAAACCATCGCTGGGCAAACCGTGAACAAGAATGACCGCATTTTTGTGGACATTGGCACG
GCTAACCTAAAC
GAGAAGGTGTTCCCCCACCCTGTAGCCGTGGACATCTCTCGTTCGACGAAAGAGGCTCTTTTCGCCGAGGGTGTGTTTGAGTATCTTGGGGAACATTTGACTGTCAAG
GTAATGGGTGAGGTGTTACGCGCTGTCTTCGACCTCAACAACGTTTCGCGAGCCCCTGGTCAATCGGGAGTGCTGAAACGGTTTAAGGTGCACACCCGACCTGAATGTCGTTACGGATAC
CTCAACCACAGTCAAATTGCTTATGAATGGCCCACGTCGATGGCCATCCAATATTCAAAGTGA

Retrieve as FASTA