Entry information : PplLDS01-1 ( PplLDS01a)
Entry ID 6654
Creation 2009-03-29 (Christophe Dunand)
Last sequence changes 2012-04-06 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-11 (Christophe Dunand)
Peroxidase information: PplLDS01-1 ( PplLDS01a)
Name (synonym) PplLDS01-1 ( PplLDS01a)
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer Alkaline treatment
Repressor N/D
Best BLASTp hits
Perox score E-value PplLDS01-1
start..stop
S start..stop
PplLDS01-2 2042 0 1..1004 1..1004
JargLDS01 1122 0 7..1005 5..1067
LbiLDS01 961 0 15..1005 14..1070
CcinLDS01 904 0 4..1007 1..1088
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..177 177 N° 2 242..304 63 N° 3 363..447 85 N° 4 506..778 273
N° 5 852..1007 156 N° 6 1066..1175 110 N° 7 1235..1453 219 N° 8 1518..1682 165
N° 9 1745..1827 83 N° 10 1891..1925 35 N° 11 1979..2112 134 N° 12 2174..2207 34
N° 13 2259..2302 44 N° 14 2358..2405 48 N° 15 2457..2595 139 N° 16 2651..2976 326
N° 17 3029..3208 180 N° 18 3259..3344 86 N° 19 3398..3518 121 N° 20 3570..3855 286
N° 21 3916..3920 5 N° 22 3972..4015 44 N° 23 4072..4099 28 N° 24 4149..4228 80
N° 25 4278..4368 91 N° 26 4427..4438 12  
join(1..177,242..304,363..447,506..778,852..1007,1066..1175,1235..1453,1518..168 2,1745..1827,1891..1925,1979..2112,2174..2207,2259..2302,2358..2405,2457..2595,2 651..2976,3029..3208,3259..3344,3398..3518,3570..3855,3916..3920,3972..4015,4072 ..4099,4149..4228,4278..4368,4427..4438)


exon

Literature and cross-references PplLDS01-1 ( PplLDS01a)
Literature Lucas,S., Rokhsar,D., Wang,M., Lindquist,E.A., Challacombe,J., Grigoriev,I., Brettin,T. and Cullen,D. DOE Joint Genome Institute Postia placenta EST project
DNA ref. JGI genome:   scaffold_130 (159655..155218)
EST ref. GenBank:   FL618119.1   FL621887.1 [3' end]
Protein sequence: PplLDS01-1 ( PplLDS01a)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1007
PWM (Da):   %s   110451.73  
PI (pH):   %s   5.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVNLNPVLNPLKNTIDFVAESDAPVDQDGGHPLPPLLARKITDVEQEAIRGPGFTPADLPAYINAVKTLNGPGLDDRKFLLEKVLTLMARAPDDSAFAATLQKFAIDILYKDLPHPPSGYLALPSGAPPAASPITKGVKYAYRSADGSDYHVLIPTLGMAGTPYARSVPSTTRIPPQYLPDPGLVFDTLLKREKFVEHPGGISSLFFAFADLVIHSIFNTNTRDWTINDASSYLDLSPLYGSSQAQVDSVRRKDGTGRLYEDVFADPRLLFMPPASCALLVLFCRNHYVAERILAINELGSYRAPSTLGAQERAAQDEELFQRARLVNSALFMQVILGDYVGAILGLTRDGLAWRLDPLAAMRELNHAFSPQGEGNVVAVEFNLMYRWHATSSVSDTQWIENLFGELFPGKSWSDISVNDFRTAIIKYVMGTPQDVKEWSFDNLKRGPDGRYDVELANILQSATEAPASAFGARGTPEVLRVIEILGIMQARSWGTCLNEFRSFMGLKPYSTFAEWNPDPKIKAAEALYHDIDNLELYAGLQAEETKVPMPGAGLCPGYTISRAILADAVCLTRGDRFLTVDLTPFNLTTWGYQDCQYKKDDGSIGGILSKLLFRTLPNQYPADSAYAFFPFMVPKTMKGHVAADAVNKYSWDRPALAAPVTSLLGPSVSAPVSEYEKRLKAILGGVVPDRAVRQVLFSDASIQQWAQSFQEITQQLLKTKSVDHVDSKAKYVNIVRDVINVLPVVWISNFIVGLPLKTETNPHGVYREHDLLTKWSDIGNYVFLDQSPEGQFALRGKCTETAKDVTGFVKGHCAELSGHLSGFADSVVDYVTGGNEHERSFIKSLLAGRHGSHDALAAGVIAEVVATAPLYSRILAEVVDYYLDDGKRARLVSVLTGESVNRDEKLLALIREALPGDVQKLDAARSVDFGLLDHRFLATAFTVLRTIFSLKDLKRAPGSSGSLNRFADDTNGELRPVYLTSQGSVTPWPVSMLVYNL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (23 introns) and 12 ESTs. Also found in scaffold_37 (22368..26751).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCAACCTGAACCCCGTTCTCAACCCGCTCAAGAATACCATCGACTTTGTTGCCGAGAGCGACGCCCCCGTCGACCAGGATGGCGGGCACCCCCTCCCTCCTCTACTCGCCCGCAAA
ATCACGGACGTCGAGCAGGAAGCTATCCGTGGGCCCGGCTTCACTCCCGCCGACCTG
GTAAGCCACCGGTATATCGTCGGACTTATGCGCTGAATGTAGCTCACAACCCTTTGCGCCTTA
GCCTGCATATATCAACGCCGTAAAGACTCTCAATGGCCCTGGTCTTGACGACCGCAAGTTCCTGGTGAGCATCCCGGGCCTATTGAGTGTTGCTGGCAACGTCCGACGACGCGTACCTGC
AGCTCGAGAAGGTGCTCACGCTCATGGCGCGCGCCCCGGACGACTCGGCCTTCGCGGCAACGCTTCAAAAGTTCGCGATTGACATCCGTGAGCGCATATATGCGGTGAAATTAGCGCCCA
CTGTTCTGACCGATGTGCATACTAGTGTACAAGGACCTGCCTCATCCCCCGAGCGGGTACCTGGCACTCCCCAGCGGCGCGCCCCCGGCTGCATCGCCCATCACTAAGGGTGTCAAGTAC
GCCTACCGCAGTGCCGACGGCTCCGACTACCATGTCCTCATCCCTACCTTGGGCATGGCCGGCACGCCATACGCACGCTCTGTGCCCTCCACCACGCGCATCCCCCCGCAGTATCTCCCC
GACCCGGGCCTCGTCTTCGACACGCTCCTCAAACGCGAGAAGTTTGTCGAACATCCAG
GTACGTGCGCCGCCTGCGCTTCCCTCTCTTTCTTGCGTATATATATTCAGGCTCATGATGTC
ATGCCCTGCAGGCGGCATATCGAGCCTGTTCTTCGCCTTTGCCGACCTCGTCATCCACAGCATCTTCAACACCAACACGCGCGACTGGACCATCAACGACGCCTCCAGCTACCTCGACCT
CAGCCCCCTCTACGGCAGCTCCCAGGCGCAGGTCGACAGTGTCCGCC
GTAAGCCCTCTCGCGCACTTCAGTGCACACCTGCTGACTGTACGCGTGACGTTCGCAGGCAAGGATGGCACTG
GCAGGCTCTACGAGGACGTCTTTGCCGACCCGCGACTGCTCTTCATGCCCCCCGCGTCGTGCGCGCTGCTCGTCCTCTTCTGCCGCAACCACAAC
GTAAGCCCTCCAATCCGTGTGCACT
TCGCCGCGCGGGACTCACCGCGCTTGGCACGCAGTACGTTGCCGAGAGGATCCTCGCCATCAACGAGCTCGGGAGTTATCGCGCGCCCAGCACGCTCGGCGCGCAGGAGCGCGCCGCACA
GGACGAGGAGCTCTTCCAGCGCGCGCGCCTCGTCAACAGCGCGCTCTTCATGCAGGTCATCCTGGGCGACTACGTCGGCGCGATCCTTGGCCTCACGCGCGACGGCCTCGCGTGGCGCCT
CGACCCGCTCGCG
GTGCGTCTGTGTATGCGTGGGCGCGTGTGTGCATGTGCTGACGCGCGATCGGCGCCCCCCACAGGCCATGCGCGAGCTCAACCACGCGTTCTCGCCGCAGGGCGAGG
GCAACGTCGTCGCGGTCGAGTTCAACCTGATGTACCGCTGGCATGCGACGAGCTCCGTGTCCGACACGCAGTGGATCGAGAACCTCTTTGGAGAGCTCTTCCCGGGGAAGTCGTGGAGTG
AC
GTAAGCACCTTCATCGCGCGCGTGCGCGCGTGCGGGTGTCTGACCTCAGTGCTATGGGACAGATCTCCGTGAATGACTTCCGCACCGCCATCATCAAGTATGTGATGGGCACGCCGCA
GGACGTGAAGGAGTGGTCGTTTGACAA
GTAAGGAAACGCGCGCTTCGTGCTGGCGTAATTTTCGATTGAAGGGAATTCCTTTATGAACAGCCTGAAGCGTGGTCCGGACGGCCGTTACGA
CGACG
GTGGGTGTGCACTCTCCCACGGGCGAGCGCGTTCGCTGACGACGTGTTTGCAGTGGAGCTCGCGAACATTCTGCAGAGCGCGACTGAGGCCCCCGCGAGTGCGTTCGGGGCGCGC
GGCACGCCCGAGGTACTGCGCGTGATCGAGATCCTCGGCATCATGCAGGCTAGGAGCTGGGGGACGTGCTCG
GTGCGTGCCATATCGATTCCGTCGCACCCTGCGGAAGTCTGATGCATA
TGCTATCCGCCAGTTGAACGAGTTCAGGAGCTTCATGGGCCTGAAGCGTGAGTGCCAGCAGCTGGGTGGTCAGAGCCCTCAGTTGACGCGTTTTACAGCTTATAGCACCTTCGCGGAGTG
GAACCCCGATCCGAAGATCTAC
GTACGCGATTTTTTCATCGCGTCCCGCTCGGTCAGATCGCTGACGCCCGCTGTAGAAGGCAGCGGAAGCCTTGTACCACGACATCGACAACCTGGAGC
TTTAC
GTAGGGACACTCTTCTTAGGAGATATGCTCTTGACTCAGTCTTGTGTGTAGGCCGGGCTGCAAGCGGAGGAGACCAAGGTGCCGATGCCAGGTGCAGGCCTGTGCCCGGGTTACA
CAATCTCGCGCGCGATCCTTGCGGACGCTGTGTGCCTCACCCGTGGCGACCGCTTCCTCACTGTGGACCTCACGC
GTAAGTCCGTTCCAGAAAGCACCCTGCTGAAACTGGCACTCACGC
GCCGTTCCAGCGTTCAACCTCACGACCTGGGGCTACCAGGACTGCCAGTATAAGAAGGATGACGGCTCGATCGGCGGCATCCTGTCCAAGCTGCTCTTCCGCACGCTGCCAAACCAGTAC
CCTGCCGACTCTGCGTACGCGTTCTTCCCGTTCATGGTGCCCAAGACGATGAAGGGCCACGTCGCGGCGGACGCGGTGAACAAGTACTCCTGGGACAGGCCTGCGCTGGCTGCCCCAGTC
ACCTCGCTGCTGGGCCCTAGCGTGTCCGCTCCCGTCTCGGAGTATGAAAAGCGTCTCAAGGCAATCTTGGGCGGCGTTGTGCCTGACCGAGCGGCG
GTATGCAGCCCCTCCTGCGTTGAC
GTGCAGGTGCCTGATGGTAGCGGCATAGGTTCGGCAAGTTCTCTTTAGCGACGCGTCCATCCAGCAATGGGCACAGTCCTTCCAGGAGATCACGCAGCAGCTGCTCAAGACAAAGTCGGT
GGATCACGTTGACAGCAAGGCGAAATACGTCAACATCGTCCGCGATGTCATCAACGTGCTTCCCGTCGTCTGGATCTCCAACTTCATC
GTGCGTTCCTACGTCTCATGGATTGTCGCCGC
TGTCTCACGTAGAACTAGGTCGGGCTCCCTCTGAAGACGGAGACAAACCCCCACGGCGTATACCGTGAACATGACCTGCTGACAAAGTGGTCAGACATTGGAAAGTTAGTACAGTTATTT
ATGCGTCCCTTGACGACACCTGATTGCGTGACATCAGCTATGTTTTCTTGGATCAATCTCCCGAAGGCCAGTTTGCGCTTCGCGGAAAGTGTACCGAGACCGCCAAGGACGTCACCGGTT
TCGTTAAAGGTCATTGTGCCGAGCTCTCTGGCCACAGC
GTACGTCCCGCGCGCTCTGAGCTCGTGTTCAGTACTAACGAATACGTGCAGCTCTCTGGATTCGCAGATTCTGTCGTCGACT
ATGTCACAGGAGGGAATGAGCACGAGAGGTCATTTATTAAGTCGCTGCTTGCTGGGCGACACGGTTCGCATGATGCCCTTGCTGCGGGTGTGATCGCCGAAGTGGTCGCTACCGCACCAC
TCTACTCCCGAATCCTGGCTGAAGTCGTTGATTACTACCTCGATGATGGCAAACGCGCTCGTCTCGTCTCGGTCCTAACTGGCGAGTCAGTGAACCGCGACGAGAAACTACTCGCGCTCA
TCCGAGAGGCTCTCC
GTAAGTGCTCTTTGAGCTTGTTATACCATTGCCCTTACTGAATTATGTTGGACATTGTAGCTACCGTATGTGTAAACGTTTGTCAGACACGATGCTGCATTACTC
ATTCGTTACAGGGGGATGTGCAGAAGCTCGACGCTGCTAGATCAGTGGATTTCGGGTATGCTACACTCTACATTAGCTTATATTACCATTGCTCACTCAATTTTCCACTAGTCTGCTTGA
TCACAGGTTCCTCGCAAAG
GTAAGGCAGCCGCTGCTAATTACCCAGCTTATATTGACCTCGTCACCAGACGGCTTTCACGGTATTGCGAACAATCTTCTCCCTTAAGGATCTCAAGCGGG
CACCTGGTTCCTCGGGTAGTCTGAACCG
GTAAGTTATTTGTGATCGAAATTGGGTGTGTATGTTCATGCCGTCGCAGATTCGCAGACGACACGAACGGCGAGTTGCGTCCCGTCTACCTG
ACCTCCCAGGGATCGGTGACACCATGGCCAGTGTCAATGCTAGTTCAA
GTAGGTTTCACCCATTAGCAGTCAGAGAGCTGTATGCTGAACCGCCTCGTATTTGTAGTATAACCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCAACCTGAACCCCGTTCTCAACCCGCTCAAGAATACCATCGACTTTGTTGCCGAGAGCGACGCCCCCGTCGACCAGGATGGCGGGCACCCCCTCCCTCCTCTACTCGCCCGCAAA
ATCACGGACGTCGAGCAGGAAGCTATCCGTGGGCCCGGCTTCACTCCCGCCGACCTG
CCTGCATATATCAACGCCGTAAAGACTCTCAATGGCCCTGGTCTTGACGACCGCAAGTTCCTG
CTCGAGAAGGTGCTCACGCTCATGGCGCGCGCCCCGGACGACTCGGCCTTCGCGGCAACGCTTCAAAAGTTCGCGATTGACATCCTGTACAAGGACCTGCCTCATCCCCCGAGCGGGTAC
CTGGCACTCCCCAGCGGCGCGCCCCCGGCTGCATCGCCCATCACTAAGGGTGTCAAGTACGCCTACCGCAGTGCCGACGGCTCCGACTACCATGTCCTCATCCCTACCTTGGGCATGGCC
GGCACGCCATACGCACGCTCTGTGCCCTCCACCACGCGCATCCCCCCGCAGTATCTCCCCGACCCGGGCCTCGTCTTCGACACGCTCCTCAAACGCGAGAAGTTTGTCGAACATCCAG
GC
GGCATATCGAGCCTGTTCTTCGCCTTTGCCGACCTCGTCATCCACAGCATCTTCAACACCAACACGCGCGACTGGACCATCAACGACGCCTCCAGCTACCTCGACCTCAGCCCCCTCTAC
GGCAGCTCCCAGGCGCAGGTCGACAGTGTCCGCC
GCAAGGATGGCACTGGCAGGCTCTACGAGGACGTCTTTGCCGACCCGCGACTGCTCTTCATGCCCCCCGCGTCGTGCGCGCTGCTC
GTCCTCTTCTGCCGCAACCACAAC
TACGTTGCCGAGAGGATCCTCGCCATCAACGAGCTCGGGAGTTATCGCGCGCCCAGCACGCTCGGCGCGCAGGAGCGCGCCGCACAGGACGAGGAG
CTCTTCCAGCGCGCGCGCCTCGTCAACAGCGCGCTCTTCATGCAGGTCATCCTGGGCGACTACGTCGGCGCGATCCTTGGCCTCACGCGCGACGGCCTCGCGTGGCGCCTCGACCCGCTC
GCG
GCCATGCGCGAGCTCAACCACGCGTTCTCGCCGCAGGGCGAGGGCAACGTCGTCGCGGTCGAGTTCAACCTGATGTACCGCTGGCATGCGACGAGCTCCGTGTCCGACACGCAGTGG
ATCGAGAACCTCTTTGGAGAGCTCTTCCCGGGGAAGTCGTGGAGTGAC
ATCTCCGTGAATGACTTCCGCACCGCCATCATCAAGTATGTGATGGGCACGCCGCAGGACGTGAAGGAGTGG
TCGTTTGACAA
CCTGAAGCGTGGTCCGGACGGCCGTTACGACGACGTGGAGCTCGCGAACATTCTGCAGAGCGCGACTGAGGCCCCCGCGAGTGCGTTCGGGGCGCGCGGCACGCCCGAG
GTACTGCGCGTGATCGAGATCCTCGGCATCATGCAGGCTAGGAGCTGGGGGACGTGCTCG
TTGAACGAGTTCAGGAGCTTCATGGGCCTGAAGCCTTATAGCACCTTCGCGGAGTGGAAC
CCCGATCCGAAGATCTAC
AAGGCAGCGGAAGCCTTGTACCACGACATCGACAACCTGGAGCTTTACGCCGGGCTGCAAGCGGAGGAGACCAAGGTGCCGATGCCAGGTGCAGGCCTGTGC
CCGGGTTACACAATCTCGCGCGCGATCCTTGCGGACGCTGTGTGCCTCACCCGTGGCGACCGCTTCCTCACTGTGGACCTCACGC
CGTTCAACCTCACGACCTGGGGCTACCAGGACTGC
CAGTATAAGAAGGATGACGGCTCGATCGGCGGCATCCTGTCCAAGCTGCTCTTCCGCACGCTGCCAAACCAGTACCCTGCCGACTCTGCGTACGCGTTCTTCCCGTTCATGGTGCCCAAG
ACGATGAAGGGCCACGTCGCGGCGGACGCGGTGAACAAGTACTCCTGGGACAGGCCTGCGCTGGCTGCCCCAGTCACCTCGCTGCTGGGCCCTAGCGTGTCCGCTCCCGTCTCGGAGTAT
GAAAAGCGTCTCAAGGCAATCTTGGGCGGCGTTGTGCCTGACCGAGCGGCG
GTTCGGCAAGTTCTCTTTAGCGACGCGTCCATCCAGCAATGGGCACAGTCCTTCCAGGAGATCACGCAG
CAGCTGCTCAAGACAAAGTCGGTGGATCACGTTGACAGCAAGGCGAAATACGTCAACATCGTCCGCGATGTCATCAACGTGCTTCCCGTCGTCTGGATCTCCAACTTCATC
GTCGGGCTC
CCTCTGAAGACGGAGACAAACCCCCACGGCGTATACCGTGAACATGACCTGCTGACAAAGTGGTCAGACATTGGAAA
CTATGTTTTCTTGGATCAATCTCCCGAAGGCCAGTTTGCGCTT
CGCGGAAAGTGTACCGAGACCGCCAAGGACGTCACCGGTTTCGTTAAAGGTCATTGTGCCGAGCTCTCTGGCCACAGC
CTCTCTGGATTCGCAGATTCTGTCGTCGACTATGTCACAGGA
GGGAATGAGCACGAGAGGTCATTTATTAAGTCGCTGCTTGCTGGGCGACACGGTTCGCATGATGCCCTTGCTGCGGGTGTGATCGCCGAAGTGGTCGCTACCGCACCACTCTACTCCCGA
ATCCTGGCTGAAGTCGTTGATTACTACCTCGATGATGGCAAACGCGCTCGTCTCGTCTCGGTCCTAACTGGCGAGTCAGTGAACCGCGACGAGAAACTACTCGCGCTCATCCGAGAGGCT
CTCC
CTACCGGGGATGTGCAGAAGCTCGACGCTGCTAGATCAGTGGATTTCGGTCTGCTTGATCACAGGTTCCTCGCAAAGACGGCTTTCACGGTATTGCGAACAATCTTCTCCCTTAAG
GATCTCAAGCGGGCACCTGGTTCCTCGGGTAGTCTGAACCG
ATTCGCAGACGACACGAACGGCGAGTTGCGTCCCGTCTACCTGACCTCCCAGGGATCGGTGACACCATGGCCAGTGTCA
ATGCTAGTTCAA
TATAACCTGTAA

Retrieve as FASTA