Entry information : PplLDS02
Entry ID 6655
Creation 2009-03-30 (Christophe Dunand)
Last sequence changes 2016-02-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-11 (Achraf Jemmat)
Peroxidase information: PplLDS02
Name PplLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplLDS02
start..stop
S start..stop
JargLDS02 1165 0 1..994 61..1039
LbiLDS02 1133 0 40..994 77..1017
PinvLDS02 1113 0 1..993 79..1052
SlutLDS02 1081 0 1..994 79..1065
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 89567..89572 6 N° 2 89626..89707 82 N° 3 89763..89974 212 N° 4 90027..90091 65
N° 5 90144..90360 217 N° 6 90421..90657 237 N° 7 90725..90787 63 N° 8 90868..90969 102
N° 9 91029..91108 80 N° 10 91169..91234 66 N° 11 91295..91418 124 N° 12 91489..91504 16
N° 13 91567..91716 150 N° 14 91778..92195 418 N° 15 92249..92471 223 N° 16 92533..92618 86
N° 17 92680..92794 115 N° 18 92865..93033 169 N° 19 93093..93221 129 N° 20 93273..93302 30
N° 21 93358..93446 89 N° 22 93641..93988 348  
join(89567..89572,89626..89707,89763..89974,90027..90091,90144..90360,90421..906 57,90725..90787,90868..90969,91029..91108,91169..91234,91295..91418,91489..91504 ,91567..91716,91778..92195,92249..92471,92533..92618,92680..92794,92865..93033,9 3093..93221,93273..93302,93358..93446,93641..93988)


exon

Literature and cross-references PplLDS02
DNA ref. JGI genome:   scaffold_212 (89566..93988)
Protein sequence: PplLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1009
PWM (Da):   %s   112151.13  
PI (pH):   %s   6.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLLEHVLVYLSNHSEGSLGAKLQQATVELLYNDLPHPPETFVGNEYSWRTADGSNNNPAYPDLGKARTPYARSVQQTHPLPRNELPDAGLVFDTLLRREFTKHPAGLSSMMFAFAALVIHSVFRTSHENVSINETSSYVDLAPLYGNNQEAQDKIRVRDGRGLLHPDTFAEDRLLLLPPAVCVLLVLFNRNHYIAKMLLELNERGTYADPSTLPAGDPTRASALLAQEEDIFQTARLVNCAWFASVVFSDYFSAILGLVRDGNSWSLNPFGEIRELDHGIFERSRGNACSVEFNCLYRWHATTSQQDEQWVEQLFGQIFPDQTWDKITIKDFKQTAKKLQATEPDVTQWTFGNLKRQDGTLTFKDEQLADIIQNATAHPAGAFRARGTPHVMRLHEIMGIESNRQWGCCSLNDFRFLGLKTYSTFLEWNSDPEIASAAEKLYGHIDRLELYVGLQAEAAKPVIEGAGLCPGYTISRAILSDAIALTRGDRFFTADYTPFNMTCWGFADCQRDPNAPGYGSMLGKLFLRTLPGQFTSNSTYTWFPLMTPEAMQTVLTKLGDVALYNLNRPATIAPVPVVRDYADVAQVLGDEQQFTARYASRAGRVISGRGFFMASDDPARAEREQRALVGVLAESTDKITGFFYEKTRELMQRESYALVQSSTRAVDIVRDVLKYVPIHWASEAGIRLKSSATAEGDYTPQELFDTVSDIYSFLFLDVDASKLLKLEQKVKADVEKLLGIIRNASGGGSLSIVGFVETIAEMFLGQKKSDFDELRERLAVLGYSSNTLANTILAVLVGATVELSQANINVINFYLDENKPTDVQVLASKPSFDAKDEALLQGFVNEALRFDPPFRGVYRQATRPTAVGTQSVKSGETVFLDIASARMVSRAGSVYQGKPALLRADRAFHSRRAQIMGSVVRAVFSYKHLRRGPGQSGALKRYVVSLPALRAAADVRGSYKTDASETSTYMYLSPTQELTPWTPSMVVQVRALWRVSVAVRAY*

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGGTACGCGCTCGATTGCATTGCCACTCTCCGCTTCCCAACTGACCACCTTCGAGCTCGAGCACGTCCTGGTCTATCTCTCCAATCACTCCGAGGGCAGCCTTGGCGCGAAGCTCC
AGCAAGCCACAGTGGAACTCC
GTCTGTATTATCCTTGTTCTTGCACGGGGGCACTCGCACTGAGCTTATATCACAGTCTACAACGACTTGCCCCACCCCCCAGAGACGTTCGTAGGGAAC
GAGTACTCCTGGCGCACAGCGGACGGCTCCAACAACAACCCAGCCTATCCCGACCTGGGAAAGGCGCGCACGCCCTACGCGCGGAGCGTCCAGCAGACCCACCCGCTGCCTCGCAACGAG
CTGCCCGACGCTGGCCTCGTCTTCGACACCCTCCTGCGGCGCGAGGGA
GTGAGCTATTCGGCGTTCCTTTACCTAGTCACGCAGACTCACGCACTCGCAGTTTACGAAACACCCCGCGGG
ACTGTCAAGCATGATGTTCGCCTTTGCAGCGCTCGTCATCCACTC
GTGGGTGCTGCTTGCCACACGCTCGTGCGTTCAGGCTGACGCCGATCTGCAGGGTGTTCCGGACGTCCCACGAGA
ACGTCAGCATCAACGAGACCTCCTCCTACGTCGACCTCGCGCCTCTGTACGGCAACAACCAGGAGGCCCAGGACAAGATCCGCGTGCGCGACGGCCGCGGGCTCCTGCACCCCGACACCT
TCGCCGAGGACAGGCTGCTCCTGCTGCCGCCCGCGGTCTGCGTTCTCCTTGTGCTCTTCAACCGCAACCACAAC
GTGGGCATTCATCCTCGGACTATACATCGCGCGCAGAGTTTAACGA
CGTTTTCCCTACAGTACATCGCAAAGATGCTCCTCGAGCTGAACGAGCGGGGGACCTACGCCGACCCGTCCACGCTGCCCGCCGGCGACCCCACGCGCGCGTCCGCGCTGCTCGCGCAGG
AAGAGGACATCTTCCAGACCGCGCGCCTCGTCAACTGCGCGTGGTTCGCGTCGGTCGTGTTCTCGGACTACTTCAGCGCGATCCTCGGGCTCGTGCGGGACGGCAACAGCTGGAGCTTGA
ACCCGTTCGGG
GTGCGCGCACACACACTGCTTGGGCGGTGGCACGGCGGCTGACGCGTTGTGCATGTGCGTGGTACAGGAAATCAGGGAGCTGGACCACGGGATTTTCGAGCGCAGCCGG
GGAAACGCCTGCAGTGTCGAG
GTGGGTGCCGCATTCTGCCGGCCTTGCTGAGCGTGCACCGGGCATCGGGCATCGGTCTGACGCTGGCGTGTTTGCTGCAGTTCAACTGTCTGTACCGCT
GGCACGCGACGACCTCGCAGCAGGACGAACAGTGGGTCGAGCAGCTGTTCGGCCAGATCTTCCCCGACCAGACGTGGGACAAG
GTCAGTCGACGTCTCGAGCAGGTGTTTTGGCCAAGGC
GCTGAAATCCCCTGATATCTAGATCACGATCAAGGACTTCAAGCAAACCGCCAAGAAGCTCCAAGCGACGGAGCCGGACGTCACGCAGTGGACATTCGGAAAGTCAGTATGAGGACGTCT
ATGTGCACCGTCTTGAGCCTGCTGACCGCCCCCGCCCCCCAGCTTGAAGCGTCAGGACGGGACGCTGACGTTCAAGGACGAGCAGCTGGCGGACATTATCCAGAATGCGTGCGTCGCAGT
CGCGTGATCCTTCGTGTTGGCTCATGCGCAATGTTTCTGTTCCGCCAGGACCGCGCACCCCGCCGGCGCTTTCAGGGCGCGCGGCACCCCGCACGTCATGCGATTGCACGAGATCATGGG
GATCGAGTCCAACAGACAGTGGGGCTGCTGCTCGCTGAACGACTTTCGGAAG
GTGCGGACTCGTGCAAGTCGAACGCTCAACATACGCACGTGCTGACGTCTTCTCTTTTTCCTCCTGGC
AGTTCCTGGGTTTGAAGAGTGAGTGTCGGCGTCCATTCCAGTCGCGCGATGACACAGATCGAGCCTCATGCGTGTGTTAGCGTACTCGACCTTCCTCGAGTGGAATTCTGACCCCGAGAT
TGCCTCCGCGGCTGAGAAGCTCTATGGCCACATCGACCGGCTCGAGCTCTACGTCGGCCTGCAAGCAGAAGCCGCCAAGCCGGTCATCGAGGGCGCAGGCCTGTGCCCTG
GTAAGAGCCC
CCCTCGATACGCCTCGTTACCTATCTCTAACACGACGCGGGACACCTTCAGGGTACACGATCAGTCGCGCTATCCTCAGCGACGCGATTGCGCTCACCCGGGGTGACCGCTTCTTCACCG
CGGACTATACGCCGTTCAACATGACCTGCTGGGGCTTTGCGGACTGCCAGCGGGATCCCAACGCGCCGGGCTACGGCAGCATGCTCGGCAAGCTCTTCTTGCGGACGCTGCCCGGCCAGT
TCACCAGCAACAGCACGTACACGTGGTTCCCCCTCATGACGCCCGAGGCGATGCAGACGGTCTTGACGAAGCTGGGCGACGTCGCGCTGTACAACTTGAACCGGCCCGCGACGATCGCCC
CCGTCCCGGTGGTCAGGGACTACGCGGACGTGGCGCAGGTGTTGGGCGACGAGCAGCAGTTCACCGCGCGGTATGCCAGCCGTGCCGGGCGGGTGATCAGCGGGCGCGG
GTACGTCGGAG
GCTCCGTGCGAGGGAGGCGCCGCATTGACTGACGTGCCGCAGCTTCTTCATGGCGTCGGACGACCCCGCGCGGGCGGAGCGGGAGCAGCGCGCGCTCGTCGGCGTCCTGGCGGAGTCCAC
GGACAAGATCACGGGCTTCTTCTACGAGAAGACGCGCGAGCTGATGCAGCGCGAGTCGTATGCGCTGGTGCAGTCGAGCACGCGCGCCGTGGACATCGTGCGGGACGTGCTCAAGTACGT
GCCCATCCACTGGGCGAGCGAACTC
GTGCGTGCGCTCCGTTAACATCTGCGAGGATGACGATGGCTGACCCCGGCGCGCACGTCAGGCGGGGATACGGCTCAAGTCGAGCGCCACCGCCG
AGGGCGATTACACCCCGCAGGAGCTCTTTGATACGGTGTCCGACATCTATTC
GTGGGTGGCATTGGTGCTGTGTGCGCGTGGCTTGTGTCGACCGCTGACCCGGCACTGCCAGGTTCCTC
TTCCTGGACGTCGATGCGTCCAAACTGCTCAAGCTCGAACAGAAGGTCAAGGCTGACGTCGAGAAGCTCCTTGGTATCATCAGGAACGCGTCTGGCGGGGGCTCGAGG
GTAAGTCTAAGT
CTGTCAGCTGCTGCATGTCCCCGGCGCTGATCGGTGCGCGGCCGCCTGCGCATTCCAGCTGTCGATAGTCGGCTTCGTGGAGACGATTGCCGAGATGTTCCTCGGTCAGAAGAAGAGCGA
CTTTGACGAGCTGCGGGAGCGCCTCGCAGTCCTGGGCTACTCGTCAAACACGCTTGCGAACACCATCCTGGCGGTGCTCGTGGGTGCAACGGTGGAGTTATCACAAG
GTACGTGGCACGC
ATATCAGCGGCCGTGATCCTGTGGCTGATATATCGCTGCACGGAAGCTAACATCAACGTGATCAACTTCTATCTCGACGAGAATAAGCCGACGGATGTGCAGGTCCTGGCGTCCAAACCC
AGCTTCGACGCGAAGGACGAGGCGCTCCTGCAGGGCTTTGTCAACGAGGCTCTTC
GTACGTGCATAGATTGACTGGGGCCAGCGATATCACTAAACGGCGTGACAGGCTTCGACCCTCCG
TTCCGCGGCGTGTACC
GTGCGTCCGCTTTCTGTGAATACTGACTGCAGCAGCTAACGCACGGTGTTTTCAGGGCAAGCGACGCGCCCGACCGCTGTGGGCACTCAATCGGTGAAGTCGGG
CGAGACCGTGTTCTTGGACATCGCGAGCGCGCGCATGGAT
GTGAGTGGACGGATATTCTTGCGCGAGGCGGCGATACTCACGGGATGGTAGCCGCGCGTCTTCGTGGACCCCACCACCGT
CGATCCCCGCCGAAGCGGGGCGGAGCGGTACCTGCTGGGCGACGGCGTGTCGAGGTGAGCCTCTTTGGGCATGGTTTTGCGGGGAGTCGTGCTGATCAGATCATGGCGGCGCAGGTGTCT
CGGGCGGGATCTGTCTACCAAGGTAAGCCTGCATTGCTGCGTGCAGATCGTGCCTTTCACTCACGCCGGGCGCAGATCATGGGCAGCGTGGTTCGTGCGGTGTTTAGCTACAAGCATCTC
CGCCGCGGGCCGGGACAGTCTGGCGCGCTCAAGCGGTACGTGGTGTCTCTTCCTGCCCTGAGGGCCGCGGCTGACGTGCGCGGCAGCTACAAGACGGACGCGTCGGAGACGAGTACATAT
ATGTACCTCTCGCCGACGCAGGAGCTGACGCCGTGGACGCCGTCGATGGTCGTGCAGGTGCGTGCGTTGTGGCGGGTTTCGGTGGCGGTTCGCGCTTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGCTCGAGCACGTCCTGGTCTATCTCTCCAATCACTCCGAGGGCAGCCTTGGCGCGAAGCTCCAGCAAGCCACAGTGGAACTCCTCTACAACGACTTGCCCCACCCCCCAGAGACG
TTCGTAGGGAACGAGTACTCCTGGCGCACAGCGGACGGCTCCAACAACAACCCAGCCTATCCCGACCTGGGAAAGGCGCGCACGCCCTACGCGCGGAGCGTCCAGCAGACCCACCCGCTG
CCTCGCAACGAGCTGCCCGACGCTGGCCTCGTCTTCGACACCCTCCTGCGGCGCGAGGGA
TTTACGAAACACCCCGCGGGACTGTCAAGCATGATGTTCGCCTTTGCAGCGCTCGTCATC
CACTC
GGTGTTCCGGACGTCCCACGAGAACGTCAGCATCAACGAGACCTCCTCCTACGTCGACCTCGCGCCTCTGTACGGCAACAACCAGGAGGCCCAGGACAAGATCCGCGTGCGCGAC
GGCCGCGGGCTCCTGCACCCCGACACCTTCGCCGAGGACAGGCTGCTCCTGCTGCCGCCCGCGGTCTGCGTTCTCCTTGTGCTCTTCAACCGCAACCACAAC
TACATCGCAAAGATGCTC
CTCGAGCTGAACGAGCGGGGGACCTACGCCGACCCGTCCACGCTGCCCGCCGGCGACCCCACGCGCGCGTCCGCGCTGCTCGCGCAGGAAGAGGACATCTTCCAGACCGCGCGCCTCGTC
AACTGCGCGTGGTTCGCGTCGGTCGTGTTCTCGGACTACTTCAGCGCGATCCTCGGGCTCGTGCGGGACGGCAACAGCTGGAGCTTGAACCCGTTCGGG
GAAATCAGGGAGCTGGACCAC
GGGATTTTCGAGCGCAGCCGGGGAAACGCCTGCAGTGTCGAG
TTCAACTGTCTGTACCGCTGGCACGCGACGACCTCGCAGCAGGACGAACAGTGGGTCGAGCAGCTGTTCGGCCAGATC
TTCCCCGACCAGACGTGGGACAAG
ATCACGATCAAGGACTTCAAGCAAACCGCCAAGAAGCTCCAAGCGACGGAGCCGGACGTCACGCAGTGGACATTCGGAAACTTGAAGCGTCAGGAC
GGGACGCTGACGTTCAAGGACGAGCAGCTGGCGGACATTATCCAGAATGC
GACCGCGCACCCCGCCGGCGCTTTCAGGGCGCGCGGCACCCCGCACGTCATGCGATTGCACGAGATCATG
GGGATCGAGTCCAACAGACAGTGGGGCTGCTGCTCGCTGAACGACTTTCGGAAG
TTCCTGGGTTTGAAGACGTACTCGACCTTCCTCGAGTGGAATTCTGACCCCGAGATTGCCTCCGCG
GCTGAGAAGCTCTATGGCCACATCGACCGGCTCGAGCTCTACGTCGGCCTGCAAGCAGAAGCCGCCAAGCCGGTCATCGAGGGCGCAGGCCTGTGCCCTG
GGTACACGATCAGTCGCGCT
ATCCTCAGCGACGCGATTGCGCTCACCCGGGGTGACCGCTTCTTCACCGCGGACTATACGCCGTTCAACATGACCTGCTGGGGCTTTGCGGACTGCCAGCGGGATCCCAACGCGCCGGGC
TACGGCAGCATGCTCGGCAAGCTCTTCTTGCGGACGCTGCCCGGCCAGTTCACCAGCAACAGCACGTACACGTGGTTCCCCCTCATGACGCCCGAGGCGATGCAGACGGTCTTGACGAAG
CTGGGCGACGTCGCGCTGTACAACTTGAACCGGCCCGCGACGATCGCCCCCGTCCCGGTGGTCAGGGACTACGCGGACGTGGCGCAGGTGTTGGGCGACGAGCAGCAGTTCACCGCGCGG
TATGCCAGCCGTGCCGGGCGGGTGATCAGCGGGCGCGG
CTTCTTCATGGCGTCGGACGACCCCGCGCGGGCGGAGCGGGAGCAGCGCGCGCTCGTCGGCGTCCTGGCGGAGTCCACGGAC
AAGATCACGGGCTTCTTCTACGAGAAGACGCGCGAGCTGATGCAGCGCGAGTCGTATGCGCTGGTGCAGTCGAGCACGCGCGCCGTGGACATCGTGCGGGACGTGCTCAAGTACGTGCCC
ATCCACTGGGCGAGCGAACTC
GCGGGGATACGGCTCAAGTCGAGCGCCACCGCCGAGGGCGATTACACCCCGCAGGAGCTCTTTGATACGGTGTCCGACATCTATTCGTTCCTCTTCCTG
GACGTCGATGCGTCCAAACTGCTCAAGCTCGAACAGAAGGTCAAGGCTGACGTCGAGAAGCTCCTTGGTATCATCAGGAACGCGTCTGGCGGGGGCTCGAGG
CTGTCGATAGTCGGCTTC
GTGGAGACGATTGCCGAGATGTTCCTCGGTCAGAAGAAGAGCGACTTTGACGAGCTGCGGGAGCGCCTCGCAGTCCTGGGCTACTCGTCAAACACGCTTGCGAACACCATCCTGGCGGTG
CTCGTGGGTGCAACGGTGGAGTTATCACAAG
CTAACATCAACGTGATCAACTTCTATCTCGACGAGAATAAGCCGACGGATGTGCAGGTCCTGGCGTCCAAACCCAGCTTCGACGCGAAG
GACGAGGCGCTCCTGCAGGGCTTTGTCAACGAGGCTCTTC
GCTTCGACCCTCCGTTCCGCGGCGTGTACCGGCAAGCGACGCGCCCGACCGCTGTGGGCACTCAATCGGTGAAGTCGGGC
GAGACCGTGTTCTTGGACATCGCGAGCGCGCGCATGGAT
GTGTCTCGGGCGGGATCTGTCTACCAAGGTAAGCCTGCATTGCTGCGTGCAGATCGTGCCTTTCACTCACGCCGGGCGCAG
ATCATGGGCAGCGTGGTTCGTGCGGTGTTTAGCTACAAGCATCTCCGCCGCGGGCCGGGACAGTCTGGCGCGCTCAAGCGGTACGTGGTGTCTCTTCCTGCCCTGAGGGCCGCGGCTGAC
GTGCGCGGCAGCTACAAGACGGACGCGTCGGAGACGAGTACATATATGTACCTCTCGCCGACGCAGGAGCTGACGCCGTGGACGCCGTCGATGGTCGTGCAGGTGCGTGCGTTGTGGCGG
GTTTCGGTGGCGGTTCGCGCTTACTAG

Retrieve as FASTA