Entry information : UmFRe02
Entry ID 6656
Creation 2009-03-31 (Christophe Dunand)
Last sequence changes 2012-04-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-05 (Christophe Dunand)
Peroxidase information: UmFRe02
Name UmFRe02
Class Ferric Reductase    [Orthogroup: FRe001]
Taxonomy Eukaryota Fungi Basidiomycota Ustilaginomycetes Ustilaginaceae Ustilago
Organism Ustilago maydis    [TaxId: 5270 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value UmFRe02
start..stop
S start..stop
UmFRe01 270 8e-82 206..703 97..595
GzFRe01 204 4e-56 122..580 44..544
MgrFRe01 194 1e-52 225..654 195..626
ArubFRe01 115 4e-27 207..555 226..571
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11250..11418 169 N° 2 11516..11587 72 N° 3 11724..13594 1871  
join(11250..11418,11516..11587,11724..13594)


exon

Literature and cross-references UmFRe02
DNA ref. JGI genome:   contig_1_7 (11250..13594)
Protein sequence: UmFRe02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   703
PWM (Da):   %s   78859.85 Transmb domain:   %s   i133-152o162-184i207-229o244-266i286-304o324-346i353-370o380-402i
PI (pH):   %s   10.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPKTHTYDISIHTWTPRDLSEKVKTISDWTRRLFFGAFLPNDFDPTSNISKSAQRAQLKLERTRDVCYTRRLSTPIDELAMERAIFKRHKEVPGCVWKPGMVGPGCRPPSALKKAAMAGKDSYYEMEKYGRITSWILVAILGIVMLRGLVSRLRHSSNPKLSLAVLAIPGYKPLAAICRGIGYYRPKKIFTRKTILSAMISADHFPSLGNILTLAVPSVGLICWCFAIKPYYRPAAVWGSTPLGVRSGMIANAMFLWLFALGLKFNPLTFLTGISHEKLQFFHQWIARVILFFSIVHVVPFLWQPVHDGGFSNLKAWYYYDKIWWTGTVAFACLAWLVVSSFGYFRRMSYEFFVLQHVVAIILFLVFYFMHTRDLINSWLWLWPSIGVWGFHVLFKFANSLRISRFTGLPATVSVVDEDEKLVKVEMAAPVSWQPGQHFFLRFPGINRSAPYQTHPFTVSNLASPNQNAESHPVFFFKARTGLTGRIWQQLVLQPAVDGKTSAMLKVGLDGPYGTSFHPAAYHSDLMITGGVGMTSVLPALMTLCLSARSSRDILTSTIAIHWSIRTIRMFDAFEPSIRPMLEHLRAFGINASLHVYCYQDGVQYGESKKDEMSIASSSSLAKSMIHVHRERANVSEIVAGFVDDVASASSSSTRRSSVSVSVCGPASMLNEAANVVARLQWSHVLSRSIDELFLHTEAFGW

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1). Strain="521".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCTAAGACACACACATATGATATTTCTATCCACACATGGACACCACGCGACCTTAGTGAAAAGGTCAAAACGATCAGCGATTGGACTCGGCGCCTTTTTTTCGGAGCTTTTCTT
CCAAATGATTTCGATCCGACGTCCAATATTTCCAAGTCTGCGCAGCGAG
GTCGGTGACTTCTGGCGACTGAGTCGGATATCCCCACCTTTCAGGCAGCTTCTACAGTATGTCATTGCGCC
TTGCTCACTGTACGACATCCATGCAGCGCAACTGAAACTAGAAAGGACCCGAGATGTTTGTTACACACGCCGACTTTCAACGCCAATCGACGAGCTAGGTATTTCAAAACGTCAGCAAGA
CGAATGCTTCTTATAATCCGTGTCCTCTAGCCTAGATTGCTCTAGTCGGCACATCCGTTTGTTCCTTTGTCACCACACATCGGCTAGTAATTTCTTCACGCAACACATCTATAGCCATGG
AACGCGCCATTTTCAAGAGGCACAAAGAGGTGCCAGGGTGTGTTTGGAAGCCTGGCATGGTCGGTCCCGGCTGTCGACCACCATCCGCACTGAAAAAGGCAGCCATGGCGGGGAAGGATA
GCTACTACGAAATGGAAAAGTACGGCCGCATCACCTCCTGGATTCTGGTCGCCATTCTTGGCATCGTCATGCTTCGCGGTCTCGTCTCGAGGCTTCGTCACAGCTCGAATCCCAAACTTT
CCCTCGCCGTGCTCGCGATTCCTGGTTATAAACCGCTCGCGGCGATATGCAGAGGTATCGGCTATTATCGTCCAAAGAAGATCTTCACTCGGAAAACGATTCTAAGCGCGATGATTTCGG
CAGACCACTTCCCGTCCTTGGGCAACATCCTTACACTCGCTGTTCCTTCTGTCGGGCTCATATGCTGGTGCTTCGCCATCAAACCCTACTATCGCCCGGCCGCTGTGTGGGGAAGTACTC
CTCTAGGTGTTCGCTCGGGTATGATCGCTAACGCTATGTTCCTCTGGTTGTTTGCTCTTGGTCTCAAGTTCAATCCGCTCACGTTTCTAACGGGCATCAGCCATGAAAAGCTGCAGTTCT
TCCATCAATGGATAGCACGTGTTATTCTCTTCTTCAGCATCGTACACGTCGTTCCCTTCCTCTGGCAACCAGTCCACGATGGCGGTTTCAGCAACCTCAAGGCCTGGTACTACTACGACA
AGATCTGGTGGACGGGTACCGTTGCATTTGCATGTTTGGCTTGGCTCGTCGTCTCTTCGTTCGGCTATTTTCGACGCATGTCGTACGAGTTCTTTGTGCTTCAGCATGTGGTGGCCATCA
TCCTGTTTTTGGTCTTCTACTTTATGCACACGCGCGATCTCATCAACTCGTGGTTGTGGTTATGGCCATCAATTGGTGTGTGGGGCTTCCATGTGCTATTCAAGTTTGCAAACTCGCTCC
GCATCAGCCGATTCACTGGTCTGCCCGCAACGGTCTCGGTGGTGGACGAAGACGAAAAGCTGGTCAAGGTAGAAATGGCTGCGCCTGTGTCATGGCAGCCAGGTCAGCATTTCTTCCTGC
GCTTCCCCGGTATCAACCGATCAGCACCCTACCAGACGCACCCTTTCACCGTTAGCAACCTTGCTTCGCCGAACCAGAACGCAGAATCGCATCCGGTGTTCTTCTTCAAGGCACGCACCG
GGCTTACGGGCAGGATCTGGCAACAGCTTGTACTACAGCCTGCTGTCGATGGCAAGACCTCTGCCATGCTCAAGGTTGGACTTGACGGGCCATACGGTACGTCCTTTCACCCAGCAGCCT
ACCACTCAGACCTCATGATCACCGGCGGCGTCGGTATGACATCGGTTCTACCTGCGCTGATGACCTTATGTCTTTCGGCGAGGTCTTCGCGCGACATTCTAACGTCCACGATCGCCATAC
ACTGGTCCATCAGAACTATACGCATGTTTGACGCCTTTGAACCGTCCATCCGACCGATGCTCGAACATCTGCGTGCCTTTGGCATCAATGCGTCTTTGCACGTGTACTGCTACCAAGATG
GTGTGCAGTATGGTGAGTCGAAAAAGGACGAAATGTCGATAGCTTCTTCCTCCTCGCTCGCAAAATCGATGATCCACGTGCACAGGGAACGCGCCAACGTTTCCGAGATTGTGGCCGGAT
TCGTCGACGACGTTGCATCGGCTTCGTCATCGTCAACGAGGCGATCGTCGGTCAGCGTGTCGGTCTGCGGTCCAGCATCGATGCTCAATGAAGCCGCGAACGTTGTCGCACGACTGCAAT
GGTCCCATGTTCTCTCTAGGTCGATTGACGAACTCTTTCTTCATACTGAGGCTTTCGGCTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCTAAGACACACACATATGATATTTCTATCCACACATGGACACCACGCGACCTTAGTGAAAAGGTCAAAACGATCAGCGATTGGACTCGGCGCCTTTTTTTCGGAGCTTTTCTT
CCAAATGATTTCGATCCGACGTCCAATATTTCCAAGTCTGCGCAGCGAG
CGCAACTGAAACTAGAAAGGACCCGAGATGTTTGTTACACACGCCGACTTTCAACGCCAATCGACGAGCTA
G
CCATGGAACGCGCCATTTTCAAGAGGCACAAAGAGGTGCCAGGGTGTGTTTGGAAGCCTGGCATGGTCGGTCCCGGCTGTCGACCACCATCCGCACTGAAAAAGGCAGCCATGGCGGGG
AAGGATAGCTACTACGAAATGGAAAAGTACGGCCGCATCACCTCCTGGATTCTGGTCGCCATTCTTGGCATCGTCATGCTTCGCGGTCTCGTCTCGAGGCTTCGTCACAGCTCGAATCCC
AAACTTTCCCTCGCCGTGCTCGCGATTCCTGGTTATAAACCGCTCGCGGCGATATGCAGAGGTATCGGCTATTATCGTCCAAAGAAGATCTTCACTCGGAAAACGATTCTAAGCGCGATG
ATTTCGGCAGACCACTTCCCGTCCTTGGGCAACATCCTTACACTCGCTGTTCCTTCTGTCGGGCTCATATGCTGGTGCTTCGCCATCAAACCCTACTATCGCCCGGCCGCTGTGTGGGGA
AGTACTCCTCTAGGTGTTCGCTCGGGTATGATCGCTAACGCTATGTTCCTCTGGTTGTTTGCTCTTGGTCTCAAGTTCAATCCGCTCACGTTTCTAACGGGCATCAGCCATGAAAAGCTG
CAGTTCTTCCATCAATGGATAGCACGTGTTATTCTCTTCTTCAGCATCGTACACGTCGTTCCCTTCCTCTGGCAACCAGTCCACGATGGCGGTTTCAGCAACCTCAAGGCCTGGTACTAC
TACGACAAGATCTGGTGGACGGGTACCGTTGCATTTGCATGTTTGGCTTGGCTCGTCGTCTCTTCGTTCGGCTATTTTCGACGCATGTCGTACGAGTTCTTTGTGCTTCAGCATGTGGTG
GCCATCATCCTGTTTTTGGTCTTCTACTTTATGCACACGCGCGATCTCATCAACTCGTGGTTGTGGTTATGGCCATCAATTGGTGTGTGGGGCTTCCATGTGCTATTCAAGTTTGCAAAC
TCGCTCCGCATCAGCCGATTCACTGGTCTGCCCGCAACGGTCTCGGTGGTGGACGAAGACGAAAAGCTGGTCAAGGTAGAAATGGCTGCGCCTGTGTCATGGCAGCCAGGTCAGCATTTC
TTCCTGCGCTTCCCCGGTATCAACCGATCAGCACCCTACCAGACGCACCCTTTCACCGTTAGCAACCTTGCTTCGCCGAACCAGAACGCAGAATCGCATCCGGTGTTCTTCTTCAAGGCA
CGCACCGGGCTTACGGGCAGGATCTGGCAACAGCTTGTACTACAGCCTGCTGTCGATGGCAAGACCTCTGCCATGCTCAAGGTTGGACTTGACGGGCCATACGGTACGTCCTTTCACCCA
GCAGCCTACCACTCAGACCTCATGATCACCGGCGGCGTCGGTATGACATCGGTTCTACCTGCGCTGATGACCTTATGTCTTTCGGCGAGGTCTTCGCGCGACATTCTAACGTCCACGATC
GCCATACACTGGTCCATCAGAACTATACGCATGTTTGACGCCTTTGAACCGTCCATCCGACCGATGCTCGAACATCTGCGTGCCTTTGGCATCAATGCGTCTTTGCACGTGTACTGCTAC
CAAGATGGTGTGCAGTATGGTGAGTCGAAAAAGGACGAAATGTCGATAGCTTCTTCCTCCTCGCTCGCAAAATCGATGATCCACGTGCACAGGGAACGCGCCAACGTTTCCGAGATTGTG
GCCGGATTCGTCGACGACGTTGCATCGGCTTCGTCATCGTCAACGAGGCGATCGTCGGTCAGCGTGTCGGTCTGCGGTCCAGCATCGATGCTCAATGAAGCCGCGAACGTTGTCGCACGA
CTGCAATGGTCCCATGTTCTCTCTAGGTCGATTGACGAACTCTTTCTTCATACTGAGGCTTTCGGCTGGTGA

Retrieve as FASTA