Entry information : CcinNOx01
Entry ID 6660
Creation 2009-04-03 (Christophe Dunand)
Last sequence changes 2009-04-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinNOx01
Name CcinNOx01
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinNOx01
start..stop
S start..stop
LbiNOx01 1025 0 1..558 1..559
PcarNOx01 965 0 1..558 1..559
PcNOx01 958 0 1..558 1..559
AbNOx01_bisporus 948 0 1..558 1..557
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1490954..1491064 111 N° 2 1490626..1490896 271 N° 3 1490183..1490572 390 N° 4 1490025..1490125 101
N° 5 1489492..1489960 469 N° 6 1489203..1489432 230 N° 7 1489050..1489142 93 N° 8 1488982..1488993 12
complement(join(1488982..1488993,1489050..1489142,1489203..1489432,1489492..1489 960,1490025..1490125,1490183..1490572,1490626..1490896,1490954..1491064))


exon

Literature and cross-references CcinNOx01
DNA ref. JGI genome:   Chr_1 (1491064..1488985)
EST ref. GenBank:   DY849115.1 [5' end]   DY845733.1 [3' end]
Protein sequence: CcinNOx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   558
PWM (Da):   %s   63424.76 Transmb domain:   %s   i16-38o53-75i102-124o139-161i174-196o216-238i384-406o
PI (pH):   %s   9.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAETWFQREFLQARRLTFNVLFYGLHLAIFAYGWYSQATNQRLAGLNTLQWSVWVSRGAGLVLALDGGLILIPMLRNIIRVVRPKLTWLFPADENIWFHRQVAYSMAFWSVVHTTAHYVNFINVERTQIRKQTAQMIHYTQPGGITGHFMLLIMVVMYTTAHQKIRKQCFEAFWYTHHLAFFFMLGLYTHATGCFVRDSVHPNLTSTFPFYSTENCIGYLSWRFIIWPGIIYFGERVWREIRARRATRLSKVLVHPSGAMELRIVKPSFKYTAGQWLFLQVPELSRFQWHFTITSAPEDPYVSVHIRQVGDFTNALGERLGVGPAAVASMTKAAVKGAEKDGPSLSRGDFVEIDPATMSITLPQVRIDGPYGAPAEDVFNNEVAVLVGAGIGVTPFASILKHIWYRQKKGKLGSLRRVEFFWVCRDAPSFGWFQSLLQEVEAAQADPNFLRINIYLTQKINEDMLWNIAVNDAGADYDPLTLLRSRTMFGRPDWNSIYSRIRQAVEGGQYIPGATAQLKTKVTYFCGPSVLAKAIKEATIKNTNANVEFSFAKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo ?, 6 introns) and 10 ESTs. Strain="okayama7#130".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAAACTTGGTTTCAAAGAGAATTTCTTCAAGCTCGAAGGTTGACATTCAATGTCCTCTTCTATGGCCTCCATTTGGCTATCTTCGCCTATGGATGGTATAGTCAGGTACGTCTT
AGGCAGCGAATACCGTGCTGGGCAACAACCCTGATAGTACCGCAACAGGCAACCAATCAACGGTTAGCTGGCCTCAATACTCTCCAGTGGTCCGTTTGGGTCTCTCGAGGAGCCGGTCTC
GTTCTTGCACTCGATGGTGGCCTCATTCTCATCCCCATGCTCCGCAACATCATTCGAGTCGTTCGACCCAAGCTAACCTGGCTCTTCCCGGCCGACGAGAACATTTGGTTCCATCGACAA
GTGGCATACTCCATGGCTTTCTGGTCCGTAGTGCACACGACTGCTCACTATGTCAACTTCATCAACGTCGAGCGCACCC
GTATGTCACCTCCGATCATCCCCAAACACTGCCCTGCTCAC
CTTCATTGCCAGAAATTCGTAAACAAACCGCCCAAATGATCCACTACACCCAACCTGGTGGTATAACTGGCCACTTCATGCTCCTCATCATGGTCGTTATGTACACTACTGCCCACCAGA
AGATTCGCAAACAATGTTTCGAAGCTTTCTGGTACACCCACCACCTCGCGTTCTTCTTCATGCTCGGCCTCTACACCCATGCAACCGGTTGCTTCGTGCGAGACTCTGTCCACCCCAACT
TGACCTCGACGTTCCCCTTCTACTCGACAGAGAACTGCATTGGATACCTTAGCTGGAGGTTCATCATTTGGCCTGGTATCATCTATTTCGGAGAGCGGGTGTGGCGTGAAATCCGTGCTC
GCCGTGCTACTCGCCTTTCCAAGGTCTTGGTTCACCCCAGTG
GTAAGCAACTTTTTTTTTATGACAATAACCTTTTTTTTTTCTCACAGTACCCTGCAGGTGCTATGGAGCTCCGAATTG
TCAAGCCCAGTTTCAAGTACACCGCCGGTCAGTGGCTCTTCCTTCAAGTCCCCGAGCTCTCCCGTTTCCAATGGCATCCT
GTGCGTATCGCTTTCTGATTCACAGCATCATATTTTCTGA
TCATCTATTCCTGTAACTTGATAGTTCACCATCACGTCTGCCCCCGAGGACCCCTACGTCTCAGTTCACATTCGTCAGGTCGGTGATTTCACCAACGCTCTCGGTGAACGTCTCGGTGTA
GGCCCAGCCGCCGTTGCCTCCATGACCAAGGCCGCTGTCAAGGGTGCCGAGAAGGATGGTCCCAGCCTTTCCCGTGGCGACTTCGTTGAGATTGACCCAGCGACCATGTCAATCACCCTA
CCCCAAGTCAGGATTGATGGTCCCTATGGCGCTCCCGCCGAAGACGTCTTCAACAATGAAGTTGCTGTCCTTGTCGGTGCTGGTATCGGTGTTACTCCTTTTGCCTCCATCTTGAAGCAC
ATTTGGTACCGCCAAAAGAAAGGAAAGCTTGGTTCTCTCCGCCGAGTCGAATTCTTCTGGGTCTGTCGTGATGCCCCCTCCTTCGGTTGGTTCCAGTCTCTCCTTCAGGAAGTCGAAGCT
GCCCAAGCGGATC
GTAAGTTCCCCACCTCCTCCACCGTTGTCATCGTCCACTGATGTGTTGTTTGTTCACAGCCAACTTCTTGCGCATTAACATCTACCTCACCCAGAAGATTAATGAGG
ACATGTTGTGGAACATCGCTGTCAATGATGCCGGAGCTGATTACGATCCCTTGACATTGTTGCGATCTCGTACCATGTTCGGTCGTCCGGATTGGAACTCTATCTACAGTCGCATCAGGC
AAGCTGTCGAGGGTGGTCAGTACATCCCCGGCGCTACCGCTCAGCTGAAGACCAAGGTTGGA
GTGCGTACCCAGTCCGAGCCTTACTGTCTCGTTGATGATGGCTGACCTGTGGCATTTT
AGACATACTTCTGCGGTCCCAGCGTTCTTGCCAAAGCCATCAAGGAAGCTACGATAAAAAATACCAACGCCAACGTGGAGTTTTCGTTCGCCAAGGTACGTATTCCCAGCCCTGTCTTGT
CTCAAAGGCCTTACCCACTCTCGGCCAATAGGAACACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAAACTTGGTTTCAAAGAGAATTTCTTCAAGCTCGAAGGTTGACATTCAATGTCCTCTTCTATGGCCTCCATTTGGCTATCTTCGCCTATGGATGGTATAGTCAGGCAACCAAT
CAACGGTTAGCTGGCCTCAATACTCTCCAGTGGTCCGTTTGGGTCTCTCGAGGAGCCGGTCTCGTTCTTGCACTCGATGGTGGCCTCATTCTCATCCCCATGCTCCGCAACATCATTCGA
GTCGTTCGACCCAAGCTAACCTGGCTCTTCCCGGCCGACGAGAACATTTGGTTCCATCGACAAGTGGCATACTCCATGGCTTTCTGGTCCGTAGTGCACACGACTGCTCACTATGTCAAC
TTCATCAACGTCGAGCGCACCC
AAATTCGTAAACAAACCGCCCAAATGATCCACTACACCCAACCTGGTGGTATAACTGGCCACTTCATGCTCCTCATCATGGTCGTTATGTACACTACT
GCCCACCAGAAGATTCGCAAACAATGTTTCGAAGCTTTCTGGTACACCCACCACCTCGCGTTCTTCTTCATGCTCGGCCTCTACACCCATGCAACCGGTTGCTTCGTGCGAGACTCTGTC
CACCCCAACTTGACCTCGACGTTCCCCTTCTACTCGACAGAGAACTGCATTGGATACCTTAGCTGGAGGTTCATCATTTGGCCTGGTATCATCTATTTCGGAGAGCGGGTGTGGCGTGAA
ATCCGTGCTCGCCGTGCTACTCGCCTTTCCAAGGTCTTGGTTCACCCCAGTG
GTGCTATGGAGCTCCGAATTGTCAAGCCCAGTTTCAAGTACACCGCCGGTCAGTGGCTCTTCCTTCAA
GTCCCCGAGCTCTCCCGTTTCCAATGGCATCCT
TTCACCATCACGTCTGCCCCCGAGGACCCCTACGTCTCAGTTCACATTCGTCAGGTCGGTGATTTCACCAACGCTCTCGGTGAACGT
CTCGGTGTAGGCCCAGCCGCCGTTGCCTCCATGACCAAGGCCGCTGTCAAGGGTGCCGAGAAGGATGGTCCCAGCCTTTCCCGTGGCGACTTCGTTGAGATTGACCCAGCGACCATGTCA
ATCACCCTACCCCAAGTCAGGATTGATGGTCCCTATGGCGCTCCCGCCGAAGACGTCTTCAACAATGAAGTTGCTGTCCTTGTCGGTGCTGGTATCGGTGTTACTCCTTTTGCCTCCATC
TTGAAGCACATTTGGTACCGCCAAAAGAAAGGAAAGCTTGGTTCTCTCCGCCGAGTCGAATTCTTCTGGGTCTGTCGTGATGCCCCCTCCTTCGGTTGGTTCCAGTCTCTCCTTCAGGAA
GTCGAAGCTGCCCAAGCGGATC
CCAACTTCTTGCGCATTAACATCTACCTCACCCAGAAGATTAATGAGGACATGTTGTGGAACATCGCTGTCAATGATGCCGGAGCTGATTACGATCCC
TTGACATTGTTGCGATCTCGTACCATGTTCGGTCGTCCGGATTGGAACTCTATCTACAGTCGCATCAGGCAAGCTGTCGAGGGTGGTCAGTACATCCCCGGCGCTACCGCTCAGCTGAAG
ACCAAGGTTGGA
ACATACTTCTGCGGTCCCAGCGTTCTTGCCAAAGCCATCAAGGAAGCTACGATAAAAAATACCAACGCCAACGTGGAGTTTTCGTTCGCCAAGGAACACTTCTGA

Retrieve as FASTA