Entry information : LbiNOx01
Entry ID 6661
Creation 2009-04-02 (Christophe Dunand)
Last sequence changes 2009-04-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: LbiNOx01
Name LbiNOx01
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LbiNOx01
start..stop
S start..stop
CcinNOx01 1025 0 1..559 1..558
PcarNOx01 977 0 1..559 1..559
PcNOx01 975 0 1..559 1..559
AbNOx01_bisporus 972 0 1..559 1..557
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4488042..4488152 111 N° 2 4487718..4487988 271 N° 3 4487279..4487668 390 N° 4 4487126..4487226 101
N° 5 4486762..4487068 307 N° 6 4486549..4486713 165 N° 7 4486263..4486492 230 N° 8 4486114..4486206 93
N° 9 4486053..4486064 12  
complement(join(4486053..4486064,4486114..4486206,4486263..4486492,4486549..4486 713,4486762..4487068,4487126..4487226,4487279..4487668,4487718..4487988,4488042. .4488152))


exon

Literature and cross-references LbiNOx01
DNA ref. JGI genome:   LG_1 (4488152..4486053)
EST ref. GenBank:   EX783742.1 [3' end]   EX791261.1 [Fragment]
Protein sequence: LbiNOx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   559
PWM (Da):   %s   63481.56 Transmb domain:   %s   i16-38o53-75i102-124o139-161i174-196o216-238i380-402o
PI (pH):   %s   9.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGESWFRREFMVPRRLAFNVLFYGAHLSLFIYGWYSQATNQRLAGLNSLKYSVWTSRGAGLVLAFDGGLILLPMLRNIIRIIRPKLTWAFPADENIWFHRQVAYSLAFWAMVHTTAHYVNFINVERTQIRKQTALQIHYTQPGGITGHFMLLIMVLMYSTAHQKIRQQCFEAFWYTHHLAFFFMLGLYTHATGCFVRDTVDPDYIPTFPFYSTEHCLGYLSWRFIIWPGIIYFGERVWREIRARRATRLSKVLVHPSGAMELRIIKPSFKYTAGQWLFIQIPELSRFQWHFTITSAPEDPYVSIHIRQVGDFTRGLGDRLGVGPSVVASMTQAAMKGAEKDKMSGMSRGDYVELDPAGSSIALPSVRIDGPYGAPAEDVFGAEVAILIGAGIGVTPFASILKHIWYRQKKGKLGSLRRVEFFWVCRDAPSFGWFQSLLQEVEAAQADPNFLRINVYLTQKISEDMLWNIAVNDAGAEYDPLTLLRSRTMFGRPDWMTIFGQMKQAIEGGQYLPGSTSQLKTKVTYFCGPGALAKAIKDATVSHTNSNVEFTFAKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo ?, 7 introns) and 3 ESTs. Strain="S238N-H82".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGAAAGCTGGTTCCGTAGGGAATTTATGGTCCCACGCCGACTTGCGTTCAACGTCCTCTTTTATGGCGCTCATCTGTCGCTCTTCATATATGGATGGTATAGTCAGGTGTGTCGT
CGTGCTCCTGCATGCTATACAAGTGGCACTCATCTTCTTTACAGGCAACAAACCAGAGATTGGCTGGTCTTAACTCACTGAAATACTCTGTTTGGACATCTCGCGGCGCTGGCCTTGTTC
TTGCATTCGATGGCGGCCTCATTCTTCTTCCAATGCTTCGCAACATTATTCGAATTATTCGTCCCAAGTTAACGTGGGCATTTCCCGCCGACGAAAACATCTGGTTCCATCGTCAAGTCG
CGTATTCCCTGGCTTTCTGGGCTATGGTTCATACTACCGCTCATTATGTCAATTTCATCAACGTTGAACGTACTC
GTAGGGTCTTCCCCGTTTCTTATTTACTTACAGCTTAACCCCTAT
GCAGAGATTCGCAAGCAAACCGCACTCCAGATCCATTACACCCAGCCGGGTGGTATTACTGGGCACTTTATGCTTCTGATCATGGTTCTCATGTATTCGACTGCACATCAAAAGATCCGT
CAGCAATGCTTTGAAGCTTTCTGGTATACCCATCACCTTGCATTTTTCTTTATGCTTGGCCTATACACGCACGCGACAGGATGCTTCGTTCGCGACACCGTCGACCCAGATTACATCCCA
ACTTTCCCATTCTATAGCACAGAACATTGTCTTGGATACCTTAGTTGGCGGTTCATCATATGGCCTGGTATTATCTATTTTGGAGAGAGGGTCTGGAGAGAGATACGTGCACGGCGAGCG
ACACGCTTATCTAAAGTTCTTGTTCATCCTAGCG
GTGCGTTTTTCATTTGATGCTAGGGATGAAGTCTTAGCGTCTTTTGTATCAGGCGCCATGGAATTGCGTATCATCAAACCCAGCTT
CAAATATACAGCTGGTCAATGGCTTTTCATTCAGATCCCAGAACTGTCCCGTTTCCAGTGGCATCCG
GTACGTAGCGATTTGCACATAATTTCCGTTGAATTGGCGTTTGACAAAATGCC
GCAGTTTACTATCACATCAGCGCCTGAAGATCCCTACGTTTCTATCCATATCCGCCAAGTTGGTGATTTCACTCGAGGTCTGGGAGACCGCCTGGGTGTTGGACCGTCCGTTGTTGCTTC
AATGACTCAGGCTGCCATGAAAGGAGCTGAAAAGGATAAAATGTCAGGCATGTCTCGAGGTGACTACGTGGAATTGGATCCAGCTGGCTCTTCAATTGCTCTTCCATCCGTTCGCATTGA
TGGTCCCTATGGTGCTCCAGCGGAGGACGTGTTTGGGGCTGAAGTAGCTATTTTAATTGGTGCCGGTATCG
GTGAGTGTTTGAAGCGAGTTCAATGGATTCTGATTTATGTCGATGAAGG
TGTCACCCCCTTCGCCTCCATCCTTAAGCATATTTGGTACAGGCAGAAGAAGGGCAAACTGGGTTCCCTGCGTCGGGTTGAATTCTTCTGGGTTTGTCGAGATGCACCTTCGTTTGGTTG
GTTCCAGTCCTTGCTTCAGGAAGTCGAGGCTGCCCAAGCTGATC
GTGAGTTGCACGTTTTGGCTGGTCTCCAAATTTTATGTTTTTTTTGTTCTCGTCAGCCAATTTTTTGCGTATCAAC
GTGTACCTGACGCAGAAGATCAGCGAAGACATGCTTTGGAACATCGCTGTCAATGACGCTGGTGCTGAATATGATCCCCTCACCCTCTTACGCTCGCGCACGATGTTTGGACGCCCCGAT
TGGATGACTATCTTTGGACAAATGAAGCAAGCAATTGAGGGAGGACAATATCTTCCTGGAAGCACGTCCCAGTTAAAAACCAAAGTTGCT
GTACGAGGCCATCATCCGAAGTTGATCGCT
GACACTCAACCCCCTACCCTATATAGACATATTTCTGCGGACCTGGTGCGCTTGCTAAGGCGATCAAGGATGCTACTGTCTCCCACACCAACTCCAATGTTGAGTTCACTTTTGCAAAGG
TAAGTTGTGTCCCCCAATATTTGCTTATTGACTTGACCTTTTCTCTAGGAACATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGAAAGCTGGTTCCGTAGGGAATTTATGGTCCCACGCCGACTTGCGTTCAACGTCCTCTTTTATGGCGCTCATCTGTCGCTCTTCATATATGGATGGTATAGTCAGGCAACAAAC
CAGAGATTGGCTGGTCTTAACTCACTGAAATACTCTGTTTGGACATCTCGCGGCGCTGGCCTTGTTCTTGCATTCGATGGCGGCCTCATTCTTCTTCCAATGCTTCGCAACATTATTCGA
ATTATTCGTCCCAAGTTAACGTGGGCATTTCCCGCCGACGAAAACATCTGGTTCCATCGTCAAGTCGCGTATTCCCTGGCTTTCTGGGCTATGGTTCATACTACCGCTCATTATGTCAAT
TTCATCAACGTTGAACGTACTC
AGATTCGCAAGCAAACCGCACTCCAGATCCATTACACCCAGCCGGGTGGTATTACTGGGCACTTTATGCTTCTGATCATGGTTCTCATGTATTCGACT
GCACATCAAAAGATCCGTCAGCAATGCTTTGAAGCTTTCTGGTATACCCATCACCTTGCATTTTTCTTTATGCTTGGCCTATACACGCACGCGACAGGATGCTTCGTTCGCGACACCGTC
GACCCAGATTACATCCCAACTTTCCCATTCTATAGCACAGAACATTGTCTTGGATACCTTAGTTGGCGGTTCATCATATGGCCTGGTATTATCTATTTTGGAGAGAGGGTCTGGAGAGAG
ATACGTGCACGGCGAGCGACACGCTTATCTAAAGTTCTTGTTCATCCTAGCG
GCGCCATGGAATTGCGTATCATCAAACCCAGCTTCAAATATACAGCTGGTCAATGGCTTTTCATTCAG
ATCCCAGAACTGTCCCGTTTCCAGTGGCATCCG
TTTACTATCACATCAGCGCCTGAAGATCCCTACGTTTCTATCCATATCCGCCAAGTTGGTGATTTCACTCGAGGTCTGGGAGACCGC
CTGGGTGTTGGACCGTCCGTTGTTGCTTCAATGACTCAGGCTGCCATGAAAGGAGCTGAAAAGGATAAAATGTCAGGCATGTCTCGAGGTGACTACGTGGAATTGGATCCAGCTGGCTCT
TCAATTGCTCTTCCATCCGTTCGCATTGATGGTCCCTATGGTGCTCCAGCGGAGGACGTGTTTGGGGCTGAAGTAGCTATTTTAATTGGTGCCGGTATCG
GTGTCACCCCCTTCGCCTCC
ATCCTTAAGCATATTTGGTACAGGCAGAAGAAGGGCAAACTGGGTTCCCTGCGTCGGGTTGAATTCTTCTGGGTTTGTCGAGATGCACCTTCGTTTGGTTGGTTCCAGTCCTTGCTTCAG
GAAGTCGAGGCTGCCCAAGCTGATC
CCAATTTTTTGCGTATCAACGTGTACCTGACGCAGAAGATCAGCGAAGACATGCTTTGGAACATCGCTGTCAATGACGCTGGTGCTGAATATGAT
CCCCTCACCCTCTTACGCTCGCGCACGATGTTTGGACGCCCCGATTGGATGACTATCTTTGGACAAATGAAGCAAGCAATTGAGGGAGGACAATATCTTCCTGGAAGCACGTCCCAGTTA
AAAACCAAAGTTGCT
ACATATTTCTGCGGACCTGGTGCGCTTGCTAAGGCGATCAAGGATGCTACTGTCTCCCACACCAACTCCAATGTTGAGTTCACTTTTGCAAAGGAACATTTCTGA

Retrieve as FASTA