Entry information : CcinNOx02
Entry ID 6662
Creation 2009-04-03 (Christophe Dunand)
Last sequence changes 2009-04-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinNOx02
Name CcinNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinNOx02
start..stop
S start..stop
LbiNOx02 999 0 2..608 3..604
PcNOx02 989 0 4..608 9..609
PcarNOx02 979 0 4..608 8..611
AbNOx02_bisporus 941 0 5..608 6..609
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 936083..936464 382 N° 2 935524..936023 500 N° 3 934983..935473 491 N° 4 934857..934923 67
N° 5 934649..934801 153 N° 6 934370..934592 223 N° 7 934307..934317 11  
complement(join(934307..934317,934370..934592,934649..934801,934857..934923,9349 83..935473,935524..936023,936083..936464))


exon

Literature and cross-references CcinNOx02
Literature Tsang,A., Storms,R. and Butler,G. Expressed sequence tags from Coprinus cinereus cDNA library. Unpublished (2006).
DNA ref. JGI genome:   Chr_6 (936464..934310)
EST ref. GenBank:   DY848087.1 [5' end]   DY852291.1 [3' end]
Protein sequence: CcinNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   608
PWM (Da):   %s   69352.71 Transmb domain:   %s   i90-112o127-149i179-201o221-243i255-277o292-310i443-465o
PI (pH):   %s   9.97
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFRNSGFDFSDGKVTGPNATIAQHPDLADKLSTGSNQPVHLQRNKTERRRLQGLQRTNTFTAAPRTTQGEMGWKQRWDVWMINEGGRQLFFGTWIFLHLLVAVFGFMHYQLKDNSEGARSVFGITFPIARTAALVLHVDVIFILLPVCRNFISLLRRTPLNDIIPFDKNITFHKATAWSIVIGSAVHTLAHMVNFTKLALSIPNMTTGQRIGAFMAANFATGPGLTGWIMWLALGIMVWFAIEKRRRAHFERFWYSHHLFIVFFINWQLHGMFCMIKPDRPPYCSFNTIGVFRYWLVGGVIWIWERILREIRSRHRTHIHKVIQHPSSVMEVQIKKEKTTTRAGQYIFLSCPEISYFQWHPFTLTSAPEEDFISVHIRVAGDWTTAFSKALGCDFERKKKGDDGAVAKPAAVPPPINRPLPRVMVDGPFGSASEDFLKYETVLLVGGGIGVTPFASILKHIWYRMNNLTDAKPTRLSKVYFTWVIKDFGTAEWFHSLLHAIEEEDTQNRIEINIYLTAKLKEDEVNNIVQDVGAEKDAITSLRAPTHFGRPNWDRVFGSLCEKHPETDVGVFFCGPAPLSKTLHSMCNKYSTPKGTRFFYGKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo ?, 6 introns) and 13 ESTs. Strain="okayama7#130".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTCGAAACTCTGGCTTCGACTTTTCAGACGGCAAGGTGACTGGGCCCAATGCCACCATTGCCCAGCACCCGGATTTGGCCGACAAGCTCTCGACAGGCTCGAACCAGCCCGTA
CATCTCCAGCGAAACAAGACCGAGCGAAGACGACTCCAGGGGCTGCAGAGAACCAACACTTTCACCGCTGCGCCCAGGACCACCCAGGGGGAGATGGGCTGGAAACAGCGGTGGGATGTG
TGGATGATTAACGAGGGAGGCAGGCAACTGTTCTTTGGAACCTGGATTTTCCTCCATTTGCTCGTCGCCGTCTTTGGTTTCATGCACTACCAGCTTAAGGACAACTCGGAGGGTGCCCGG
TCGGTTTTTGGTATCACCTTCC
GTGAGTATCCAGCCGGTTTTCATCGGTTTGTGTTCTCTAGTCTAATGGATTGTCTATAGCAATTGCCCGTACCGCAGCGCTGGTCCTCCACGTCGACG
TTATCTTCATCCTTCTCCCCGTCTGCAGGAACTTCATTTCCCTCCTGCGCCGCACCCCGCTCAACGACATCATTCCTTTCGACAAGAACATCACCTTCCACAAGGCGACCGCCTGGTCCA
TCGTCATCGGCTCCGCCGTCCACACTCTGGCGCACATGGTCAACTTCACCAAGCTCGCTCTGTCCATCCCCAACATGACGACCGGTCAACGAATTGGCGCGTTCATGGCTGCCAACTTTG
CCACGGGGCCAGGTCTCACTGGTTGGATCATGTGGCTCGCCCTCGGTATCATGGTATGGTTCGCTATTGAGAAGAGGCGACGTGCCCACTTCGAGAGGTTCTGGTACTCCCACCACCTCT
TCATCGTCTTCTTCATCAACTGGCAGCTCCACGGAATGTTCTGCATGATCAAGCCCGACCGCCCGCCTTACTGCTCATTCAACACCATCGGTGTCTTCTGG
GTATGTGTTTTTCACTCTC
GACTCGGTCTTTGATTCTGATTGTTCTGTAGAGGTACTGGCTCGTCGGAGGTGTCATCTGGATCTGGGAACGAATTCTCCGTGAAATCCGCTCGAGGCACCGCACCCACATCCACAAGGT
CATCCAGCACCCCTCGAGTGTTATGGAAGTCCAAATCAAGAAAGAGAAGACCACCACCCGCGCAGGCCAATACATTTTCCTTTCATGCCCTGAGATCTCCTACTTCCAATGGCACCCTTT
CACCCTCACCAGCGCCCCCGAGGAGGACTTTATCTCCGTCCACATCCGTGTCGCTGGTGACTGGACCACGGCGTTCTCCAAGGCTCTCGGATGCGACTTTGAGAGGAAGAAAAAGGGCGA
TGATGGGGCCGTTGCCAAGCCGGCTGCCGTCCCTCCTCCCATCAACCGACCCCTTCCCCGTGTCATGGTCGACGGTCCTTTCGGCTCTGCGTCTGAAGATTTCCTCAAGTACGAGACGGT
TCTCCTCGTCGGTGGTGGTATCGGTGTTACGCCATTTGCTTC
GTACGTCGGCGGCCCATCTTTACCTCGTTTCCCTGATGCCAATCATTCTGTTGCAACAGGATCTTGAAGCACATCTGG
TACCGCATGAACAACCTGACTGATGCCAAACCTACCCGCTTGTCCAAG
GTATGCTTGCTTCGTTGTTGGTTAGGTTAACAATGATTGTAATCTTGTCGTCTAGGTCTACTTCACTTGGGT
CATCAAGGATTTCGGTACTGCCGAATGGTTCCACTCGTTGCTGCATGCCATCGAAGAGGAGGATACCCAGAACAGGATCGAGATTAACATCTACCTCACTGCCAAGTTGAAGGAGGATGA
AGTCAACAACATCATT
GTGCGTGCCAACCAATTTAACGTGAACCCGAACATACCCACTCATAAATTCTACAGGTCCAGGATGTCGGCGCTGAAAAGGACGCCATCACTTCTCTCCGAGCA
CCCACTCACTTTGGAAGACCGAACTGGGATCGTGTCTTTGGCTCGCTCTGTGAGAAGCACCCCGAGACGGATGTTGGCGTGTTCTTCTGCGGACCTGCGCCCCTGTCCAAGACACTTCAC
TCGATGTGCAATAAGTACTCGACGCCCAAGGGAACGAGGTTCTTCTACGGCAAGG
GTGAGTTATCCCCGTCTTTCCGCTCGAGCTTCCCCCTGACGACACTCCACAGAGAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTCGAAACTCTGGCTTCGACTTTTCAGACGGCAAGGTGACTGGGCCCAATGCCACCATTGCCCAGCACCCGGATTTGGCCGACAAGCTCTCGACAGGCTCGAACCAGCCCGTA
CATCTCCAGCGAAACAAGACCGAGCGAAGACGACTCCAGGGGCTGCAGAGAACCAACACTTTCACCGCTGCGCCCAGGACCACCCAGGGGGAGATGGGCTGGAAACAGCGGTGGGATGTG
TGGATGATTAACGAGGGAGGCAGGCAACTGTTCTTTGGAACCTGGATTTTCCTCCATTTGCTCGTCGCCGTCTTTGGTTTCATGCACTACCAGCTTAAGGACAACTCGGAGGGTGCCCGG
TCGGTTTTTGGTATCACCTTCC
CAATTGCCCGTACCGCAGCGCTGGTCCTCCACGTCGACGTTATCTTCATCCTTCTCCCCGTCTGCAGGAACTTCATTTCCCTCCTGCGCCGCACCCCG
CTCAACGACATCATTCCTTTCGACAAGAACATCACCTTCCACAAGGCGACCGCCTGGTCCATCGTCATCGGCTCCGCCGTCCACACTCTGGCGCACATGGTCAACTTCACCAAGCTCGCT
CTGTCCATCCCCAACATGACGACCGGTCAACGAATTGGCGCGTTCATGGCTGCCAACTTTGCCACGGGGCCAGGTCTCACTGGTTGGATCATGTGGCTCGCCCTCGGTATCATGGTATGG
TTCGCTATTGAGAAGAGGCGACGTGCCCACTTCGAGAGGTTCTGGTACTCCCACCACCTCTTCATCGTCTTCTTCATCAACTGGCAGCTCCACGGAATGTTCTGCATGATCAAGCCCGAC
CGCCCGCCTTACTGCTCATTCAACACCATCGGTGTCTTCTGG
AGGTACTGGCTCGTCGGAGGTGTCATCTGGATCTGGGAACGAATTCTCCGTGAAATCCGCTCGAGGCACCGCACCCAC
ATCCACAAGGTCATCCAGCACCCCTCGAGTGTTATGGAAGTCCAAATCAAGAAAGAGAAGACCACCACCCGCGCAGGCCAATACATTTTCCTTTCATGCCCTGAGATCTCCTACTTCCAA
TGGCACCCTTTCACCCTCACCAGCGCCCCCGAGGAGGACTTTATCTCCGTCCACATCCGTGTCGCTGGTGACTGGACCACGGCGTTCTCCAAGGCTCTCGGATGCGACTTTGAGAGGAAG
AAAAAGGGCGATGATGGGGCCGTTGCCAAGCCGGCTGCCGTCCCTCCTCCCATCAACCGACCCCTTCCCCGTGTCATGGTCGACGGTCCTTTCGGCTCTGCGTCTGAAGATTTCCTCAAG
TACGAGACGGTTCTCCTCGTCGGTGGTGGTATCGGTGTTACGCCATTTGCTTC
GATCTTGAAGCACATCTGGTACCGCATGAACAACCTGACTGATGCCAAACCTACCCGCTTGTCCAAG
GTCTACTTCACTTGGGTCATCAAGGATTTCGGTACTGCCGAATGGTTCCACTCGTTGCTGCATGCCATCGAAGAGGAGGATACCCAGAACAGGATCGAGATTAACATCTACCTCACTGCC
AAGTTGAAGGAGGATGAAGTCAACAACATCATT
GTCCAGGATGTCGGCGCTGAAAAGGACGCCATCACTTCTCTCCGAGCACCCACTCACTTTGGAAGACCGAACTGGGATCGTGTCTTT
GGCTCGCTCTGTGAGAAGCACCCCGAGACGGATGTTGGCGTGTTCTTCTGCGGACCTGCGCCCCTGTCCAAGACACTTCACTCGATGTGCAATAAGTACTCGACGCCCAAGGGAACGAGG
TTCTTCTACGGCAAGG
AGAACTTCTAG

Retrieve as FASTA