Entry information : LbiNOx02
Entry ID 6663
Creation 2009-04-03 (Christophe Dunand)
Last sequence changes 2009-04-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: LbiNOx02
Name LbiNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LbiNOx02
start..stop
S start..stop
PcNOx02 1052 0 1..604 1..609
PcarNOx02 1035 0 5..604 8..611
AbNOx02_bisporus 1004 0 1..604 1..609
CcinNOx02 999 0 3..604 2..608
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2560657..2561017 361 N° 2 2560104..2560606 503 N° 3 2559834..2560054 221 N° 4 2559506..2559781 276
N° 5 2559391..2559457 67 N° 6 2559188..2559340 153 N° 7 2559007..2559135 129 N° 8 2558863..2558956 94
N° 9 2558798..2558808 11  
complement(join(2558798..2558808,2558863..2558956,2559007..2559135,2559188..2559 340,2559391..2559457,2559506..2559781,2559834..2560054,2560104..2560606,2560657. .2561017))


exon

Literature and cross-references LbiNOx02
DNA ref. JGI genome:   LG_1 (2561017..2558798)
EST ref. GenBank:   EX777890.1 [5' end]
Protein sequence: LbiNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   604
PWM (Da):   %s   68705.49 Transmb domain:   %s   i83-105o120-142i172-194o214-236i249-271o286-304i439-461o
PI (pH):   %s   9.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAYRSSGFDFSDNAPNANLEQHPDLAANAAQPVHLQRNKTERRRLQGLQRSLTASSMKKPVEPKTLREKFSIWMINEGGRQLFFGTWIFLHLLVAVFGFMNYQLKDNLVDARALFGVTFTIARTAALILHIDVIFILLPVCRNFVSLLRRTPLNDIIPFDKNITLHKATAWSIVAGTVVHVVAHMVNFYKLAMADTDAKTTGQRVLAFLEANFNTGPGVTGWIMTVSLGIMVFFASEKRRRAHFERFWYSHHLFVVFFINWQLHGMFCMIKPDRPPYCSSNTIGVFRYWLIGGVIWISERVLREIRSRHRTYVSKVIQHPSNVMELQIKKEKTTTRAGQYIFLSCPEISYFQWHPFTLTSAPEEDYISVHIRVVGDFTQALAKAMGCDFEKKGKEETPAGGKVVGTNVNPSVNRLLPRVMVDGPFGSASEDFLKYETVLLVGAGIGVTPFASILKSIWYRMNNFNNSKPTRLSVYFTWVIRDFGVAEWFHSLLHAIEEQDTQGRIEINIYLTAKIKEDDMNNIILQDVGAEKDAITSLRAPTHFGRPNWDRVFGSIAEKHPETDVGVFFCGPAVLSKQLHQMSNKYSDPKGTRFFFGKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo ?, 7 introns) and 2 ESTs. Strain="S238N-H82".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCGTACCGTTCTTCCGGGTTTGACTTCTCCGACAATGCTCCTAATGCAAACCTTGAACAACATCCTGATCTGGCAGCCAATGCTGCACAACCAGTTCATCTTCAGCGCAATAAG
ACTGAGAGGAGGCGACTCCAGGGGCTGCAGCGGTCGTTGACGGCCTCTTCCATGAAGAAACCTGTTGAACCGAAGACCTTGCGCGAGAAGTTTAGTATTTGGATGATCAATGAGGGAGGA
CGGCAACTGTTTTTTGGTACATGGATCTTCTTGCACCTGCTGGTGGCCGTCTTCGGTTTCATGAACTATCAGCTCAAGGATAACTTGGTGGATGCGCGTGCATTGTTCGGCGTTACATTC
A
GTGCGTCTGCCTCTTTCTCGTTACAATTCTTCCTGACACTGGATTATAAGCTATCGCTCGAACAGCTGCTCTAATTCTTCATATCGACGTTATCTTCATTCTCCTCCCTGTCTGCCGTA
ACTTCGTCTCTCTGCTCCGTCGCACCCCACTTAATGACATTATTCCCTTCGACAAAAATATCACCTTGCACAAAGCCACTGCGTGGTCCATCGTTGCAGGCACTGTGGTTCATGTCGTGG
CGCACATGGTTAATTTCTACAAGTTGGCTATGGCAGATACCGATGCCAAGACAACCGGACAACGGGTTCTTGCCTTCCTCGAAGCCAATTTCAATACAGGGCCAGGCGTTACGGGGTGGA
TTATGACGGTTTCTTTGGGAATCATGGTGTTTTTCGCCAGTGAGAAGAGACGTCGTGCTCACTTTGAGAGGTTTTGGTATTCGCACCATCTGTTCGTTGTGTTCTTCATCAATTGGCAGT
TGCATGGCATGTTCTGCATGATCAAACCCGACCGCCCTCCTTATTGCTCTTCCAACACTATCGGAGTCTTTTGG
GTGAGTTTTACTCTTCATCCTTTGTCAGTTTCTCATTGAAACCCCA
CAGCGCTATTGGCTCATTGGAGGCGTCATTTGGATTTCTGAGCGTGTCCTCCGCGAAATCCGCTCCCGTCACAGGACATATGTTTCGAAGGTCATCCAACATCCATCCAATGTCATGGAG
CTTCAGATCAAGAAGGAGAAGACAACCACCAGAGCTGGTCAATACATCTTCCTTTCCTGCCCCGAGATTTCATACTTTCAATGGCACCCTTTCACCCTTACAAG
GTTTTTTCTTCCTTTT
GCTCCCTCCCATAGGCTGTTATTGATTGTTCGAAAGTGCTCCTGAGGAAGACTACATCTCTGTCCACATCCGTGTCGTCGGCGACTTTACTCAAGCCTTAGCAAAGGCCATGGGTTGCGA
TTTCGAGAAGAAGGGCAAGGAAGAAACCCCCGCTGGCGGAAAAGTTGTTGGAACAAATGTCAACCCTTCCGTCAACCGACTGTTGCCCCGCGTCATGGTGGATGGTCCCTTTGGAAGTGC
GAGCGAGGACTTTTTGAAATACGAAACCGTCTTGCTCGTTGGTGCTGGTATCGGTGTCACTCCCTTTGCATC
GTGAGTCCCTCCTCCAGCCCATTCTCAGTTGTTGATTTACGGTCACAG

AATTCTGAAATCGATCTGGTATCGCATGAATAACTTTAACAACTCAAAGCCTACAAGGTTGTCCAAG
GTCTGCATTTAGTAACTCCTGTGAATTTAGACGTGTAAATTCGAATGCAGGTT
TACTTCACTTGGGTTATTCGTGACTTCGGCGTCGCAGAATGGTTCCACTCGCTCCTCCACGCCATAGAGGAGCAGGATACCCAAGGGAGAATTGAGATCAACATCTATCTTACGGCGAAG
ATCAAGGAGGACGACATGAATAACATTATT
GCACGTTTTTTCCCCAAAACAAAGAGTACTTTACTAACTTTTGCTCGTGTAGCTCCAAGATGTTGGCGCTGAGAAGGACGCCATCACCTC
TCTTCGTGCACCTACTCACTTCGGAAGGCCCAACTGGGATCGCGTGTTTGGCTCCATCGCTGAGAAGCATCCTGAGACTGATGTTGGGGTG
GTGAGCATCTTGCCAATTACGATAGTCCT
TTACCGAATGTCGTTCTGCAGTTCTTCTGCGGCCCTGCTGTCCTTTCAAAGCAACTCCACCAAATGTCGAACAAATACTCTGATCCTAAAGGAACCAGATTCTTCTTCGGAAAAGGCAAG
TCTACCCACTCTTAAAAGATTATGGCTGACCCCGTTACCCCTCCTCTAGAGAATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCGTACCGTTCTTCCGGGTTTGACTTCTCCGACAATGCTCCTAATGCAAACCTTGAACAACATCCTGATCTGGCAGCCAATGCTGCACAACCAGTTCATCTTCAGCGCAATAAG
ACTGAGAGGAGGCGACTCCAGGGGCTGCAGCGGTCGTTGACGGCCTCTTCCATGAAGAAACCTGTTGAACCGAAGACCTTGCGCGAGAAGTTTAGTATTTGGATGATCAATGAGGGAGGA
CGGCAACTGTTTTTTGGTACATGGATCTTCTTGCACCTGCTGGTGGCCGTCTTCGGTTTCATGAACTATCAGCTCAAGGATAACTTGGTGGATGCGCGTGCATTGTTCGGCGTTACATTC
A
CTATCGCTCGAACAGCTGCTCTAATTCTTCATATCGACGTTATCTTCATTCTCCTCCCTGTCTGCCGTAACTTCGTCTCTCTGCTCCGTCGCACCCCACTTAATGACATTATTCCCTTC
GACAAAAATATCACCTTGCACAAAGCCACTGCGTGGTCCATCGTTGCAGGCACTGTGGTTCATGTCGTGGCGCACATGGTTAATTTCTACAAGTTGGCTATGGCAGATACCGATGCCAAG
ACAACCGGACAACGGGTTCTTGCCTTCCTCGAAGCCAATTTCAATACAGGGCCAGGCGTTACGGGGTGGATTATGACGGTTTCTTTGGGAATCATGGTGTTTTTCGCCAGTGAGAAGAGA
CGTCGTGCTCACTTTGAGAGGTTTTGGTATTCGCACCATCTGTTCGTTGTGTTCTTCATCAATTGGCAGTTGCATGGCATGTTCTGCATGATCAAACCCGACCGCCCTCCTTATTGCTCT
TCCAACACTATCGGAGTCTTTTGG
CGCTATTGGCTCATTGGAGGCGTCATTTGGATTTCTGAGCGTGTCCTCCGCGAAATCCGCTCCCGTCACAGGACATATGTTTCGAAGGTCATCCAA
CATCCATCCAATGTCATGGAGCTTCAGATCAAGAAGGAGAAGACAACCACCAGAGCTGGTCAATACATCTTCCTTTCCTGCCCCGAGATTTCATACTTTCAATGGCACCCTTTCACCCTT
ACAAG
TGCTCCTGAGGAAGACTACATCTCTGTCCACATCCGTGTCGTCGGCGACTTTACTCAAGCCTTAGCAAAGGCCATGGGTTGCGATTTCGAGAAGAAGGGCAAGGAAGAAACCCCC
GCTGGCGGAAAAGTTGTTGGAACAAATGTCAACCCTTCCGTCAACCGACTGTTGCCCCGCGTCATGGTGGATGGTCCCTTTGGAAGTGCGAGCGAGGACTTTTTGAAATACGAAACCGTC
TTGCTCGTTGGTGCTGGTATCGGTGTCACTCCCTTTGCATC
AATTCTGAAATCGATCTGGTATCGCATGAATAACTTTAACAACTCAAAGCCTACAAGGTTGTCCAAGGTTTACTTCACT
TGGGTTATTCGTGACTTCGGCGTCGCAGAATGGTTCCACTCGCTCCTCCACGCCATAGAGGAGCAGGATACCCAAGGGAGAATTGAGATCAACATCTATCTTACGGCGAAGATCAAGGAG
GACGACATGAATAACATTATT
CTCCAAGATGTTGGCGCTGAGAAGGACGCCATCACCTCTCTTCGTGCACCTACTCACTTCGGAAGGCCCAACTGGGATCGCGTGTTTGGCTCCATCGCT
GAGAAGCATCCTGAGACTGATGTTGGGGTG
TTCTTCTGCGGCCCTGCTGTCCTTTCAAAGCAACTCCACCAAATGTCGAACAAATACTCTGATCCTAAAGGAACCAGATTCTTCTTCGGA
AAAG
AGAATTTCTAG

Retrieve as FASTA