Entry information : CcinHCMDn
Entry ID 6670
Creation 2009-04-04 (Christophe Dunand)
Last sequence changes 2009-04-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-17 (Christophe Dunand)
Peroxidase information: CcinHCMDn
Name CcinHCMDn
Class Hydrolase-CMD fusion (no peroxidase activity)    [Orthogroup: HCMDn001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinHCMDn
start..stop
S start..stop
CcinHCMDn[P] 575 0 210..552 1..344
LbiHCMDn 425 1e-143 4..551 12..568
UmHCMDn 328 4e-107 7..550 4..501
AfumCMDn01 99 9e-24 8..202 51..238
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2176702..2176911 210 N° 2 2176228..2176647 420 N° 3 2175149..2176177 1029  
complement(join(2175149..2176177,2176228..2176647,2176702..2176911))


exon

Literature and cross-references CcinHCMDn
Literature Tsang,A., Storms,R. and Butler,G. Expressed sequence tags from Coprinus cinereus cDNA library
DNA ref. JGI genome:   Chr_8 (2176911..2175152)
EST ref. GenBank:   DY843927.1 [5' end]   DY847424.1 [3' end]
Protein sequence: CcinHCMDn
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   552
PWM (Da):   %s   59588.67  
PI (pH):   %s   6.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKSKLLPGRYPAPGTDPVADAIRKRRGERGLTALDGNLLHFAEGARGYNDLLGALRTGGKVPGDLRELMILRIAALNHAAYEWVQHEPIGRKEGLSTGQLYSIRDIDTPLPPAKGLFTPLQEAALDFVDKLTLVSSSSFTVDHGVKYKDALRKYVEGTGHSEVEELTNALYSESSMLVATYNLVSRFLVATDVDGRAEQQVPWPVERVEHNVTLPSFPKSEATHQIYAVTLRHPEQDAPWIVLSNSLLTSTRMWGWIVPYLLDGGFHASGGNSKRRYNILLHDQRGHGRSTLPPNPADSVRYHDDDSARRSTIPLLAWDVQNLLVSDEIKEVIDGDSKGLKPIHAVIGVSQGGACAMAFGASYPTSSGSPDTTARKTKAIIACDTSARTPAGNRDAWKERVGLVFGGAGLDDAQSVGLSRLADVTLPRWFPAASPLPPSRAALVRKMVEETPVEGFVEGARALGSYDLLEGSTGEKLDMPGRPPLLEGRDLKVLLVAGSLDGNGKVGEGLKGLAEKWDRADYKAVEGSGHLPMVDRPEVWCEVVGDWLGGL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 2 introns) and 2 ESTs. Note that the hydrolase protein is placed DOWNSTREAM from the CMD domain (unlike most of HCMD proteins from bacteria). Strain="okayama7#130".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGAAATCTAAGCTCCTACCAGGCCGGTATCCTGCTCCCGGAACAGACCCGGTCGCAGATGCTATTCGCAAACGACGGGGAGAAAGGGGGCTGACAGCTCTCGATGGGAACCTTTTG
CACTTTGCTGAAGGCGCGAGAGGCTACAATGACCTTCTTGGGGCGCTGAGGACGGGTGGGAAGGTCCCTGGAGATCTGAGGGAGTTGATG
GTGCGTTATCTGTTGGTCTATGAGTGTCAT
AGTCTGACCTTGGAGGCTGCATAGATCCTGAGAATCGCTGCGTTGAACCATGCAGCCTACGAATGGGTTCAACACGAACCGATCGGACGCAAGGAAGGATTGTCCACTGGCCAACTCTAT
TCTATCCGCGACATCGACACTCCCCTTCCGCCTGCCAAAGGTCTATTTACGCCACTGCAAGAAGCTGCTCTGGACTTTGTAGACAAGCTGACACTGGTCAGTTCCTCCAGCTTCACCGTC
GATCATGGCGTGAAGTACAAGGATGCACTGCGGAAATACGTCGAAGGCACTGGCCACTCGGAGGTGGAAGAGCTGACGAACGCTCTGTATTCCGAATCATCGATGCTGGTGGCGACCTAT
AACCTCGTCTCTCGCTTCCTCGTTGCGACTGATGTCGATGGGCGTGCGGAGCAACAAGTTCCATGGCCCGTCGAACGAGTCGAG
GTGCGTACAATACCCTGAAGAAATGGTATTGGCTCT
GACTTTATCCTCAGCATAATGTCACCTTACCTTCGTTCCCAAAATCAGAAGCTACCCACCAGATTTACGCTGTCACTTTGCGGCATCCAGAACAGGATGCGCCGTGGATCGTCCTTTCGA
ACTCTCTACTCACGTCGACCAGGATGTGGGGATGGATCGTTCCCTATTTGCTTGATGGAGGCTTTCATGCCTCCGGCGGGAACTCAAAGCGCCGGTATAACATTCTCTTGCACGACCAAC
GCGGTCACGGGCGTTCCACTCTTCCACCCAATCCGGCCGACAGTGTTCGCTATCACGATGATGATTCAGCCCGACGCTCGACTATCCCGCTCCTCGCTTGGGATGTGCAGAATCTCCTCG
TCTCGGACGAGATCAAGGAAGTCATCGACGGCGACTCGAAGGGTCTGAAACCCATTCATGCAGTCATTGGCGTCTCACAGGGAGGGGCATGCGCCATGGCATTTGGCGCCAGCTACCCCA
CATCGAGCGGAAGCCCGGACACCACTGCGCGCAAGACGAAAGCCATAATCGCATGCGACACCTCCGCTCGAACACCGGCTGGTAATAGAGATGCGTGGAAAGAGAGGGTCGGACTTGTCT
TTGGCGGAGCGGGACTGGACGACGCTCAGAGCGTTGGGCTGTCGCGTCTGGCCGATGTCACGCTCCCTCGATGGTTCCCCGCTGCCTCGCCACTCCCACCCTCAAGGGCAGCGTTGGTGA
GGAAGATGGTCGAGGAGACACCTGTTGAAGGGTTCGTGGAAGGAGCGAGGGCGTTGGGGTCGTATGATTTGTTGGAGGGTTCGACGGGGGAGAAACTGGATATGCCGGGAAGGCCCCCGC
TTTTGGAGGGCAGGGATCTGAAAGTTTTGCTCGTCGCGGGGAGCTTGGACGGGAACGGGAAGGTCGGGGAAGGGCTGAAGGGGCTGGCGGAGAAGTGGGACCGAGCTGACTACAAGGCTG
TTGAAGGATCAGGGCACCTGCCTATGGTCGATCGCCCTGAGGTGTGGTGTGAAGTGGTTGGTGACTGGTTGGGTGGTCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGAAATCTAAGCTCCTACCAGGCCGGTATCCTGCTCCCGGAACAGACCCGGTCGCAGATGCTATTCGCAAACGACGGGGAGAAAGGGGGCTGACAGCTCTCGATGGGAACCTTTTG
CACTTTGCTGAAGGCGCGAGAGGCTACAATGACCTTCTTGGGGCGCTGAGGACGGGTGGGAAGGTCCCTGGAGATCTGAGGGAGTTGATG
ATCCTGAGAATCGCTGCGTTGAACCATGCA
GCCTACGAATGGGTTCAACACGAACCGATCGGACGCAAGGAAGGATTGTCCACTGGCCAACTCTATTCTATCCGCGACATCGACACTCCCCTTCCGCCTGCCAAAGGTCTATTTACGCCA
CTGCAAGAAGCTGCTCTGGACTTTGTAGACAAGCTGACACTGGTCAGTTCCTCCAGCTTCACCGTCGATCATGGCGTGAAGTACAAGGATGCACTGCGGAAATACGTCGAAGGCACTGGC
CACTCGGAGGTGGAAGAGCTGACGAACGCTCTGTATTCCGAATCATCGATGCTGGTGGCGACCTATAACCTCGTCTCTCGCTTCCTCGTTGCGACTGATGTCGATGGGCGTGCGGAGCAA
CAAGTTCCATGGCCCGTCGAACGAGTCGAG
CATAATGTCACCTTACCTTCGTTCCCAAAATCAGAAGCTACCCACCAGATTTACGCTGTCACTTTGCGGCATCCAGAACAGGATGCGCCG
TGGATCGTCCTTTCGAACTCTCTACTCACGTCGACCAGGATGTGGGGATGGATCGTTCCCTATTTGCTTGATGGAGGCTTTCATGCCTCCGGCGGGAACTCAAAGCGCCGGTATAACATT
CTCTTGCACGACCAACGCGGTCACGGGCGTTCCACTCTTCCACCCAATCCGGCCGACAGTGTTCGCTATCACGATGATGATTCAGCCCGACGCTCGACTATCCCGCTCCTCGCTTGGGAT
GTGCAGAATCTCCTCGTCTCGGACGAGATCAAGGAAGTCATCGACGGCGACTCGAAGGGTCTGAAACCCATTCATGCAGTCATTGGCGTCTCACAGGGAGGGGCATGCGCCATGGCATTT
GGCGCCAGCTACCCCACATCGAGCGGAAGCCCGGACACCACTGCGCGCAAGACGAAAGCCATAATCGCATGCGACACCTCCGCTCGAACACCGGCTGGTAATAGAGATGCGTGGAAAGAG
AGGGTCGGACTTGTCTTTGGCGGAGCGGGACTGGACGACGCTCAGAGCGTTGGGCTGTCGCGTCTGGCCGATGTCACGCTCCCTCGATGGTTCCCCGCTGCCTCGCCACTCCCACCCTCA
AGGGCAGCGTTGGTGAGGAAGATGGTCGAGGAGACACCTGTTGAAGGGTTCGTGGAAGGAGCGAGGGCGTTGGGGTCGTATGATTTGTTGGAGGGTTCGACGGGGGAGAAACTGGATATG
CCGGGAAGGCCCCCGCTTTTGGAGGGCAGGGATCTGAAAGTTTTGCTCGTCGCGGGGAGCTTGGACGGGAACGGGAAGGTCGGGGAAGGGCTGAAGGGGCTGGCGGAGAAGTGGGACCGA
GCTGACTACAAGGCTGTTGAAGGATCAGGGCACCTGCCTATGGTCGATCGCCCTGAGGTGTGGTGTGAAGTGGTTGGTGACTGGTTGGGTGGTCTCTAA

Retrieve as FASTA