Entry information : LbiHCMDn
Entry ID 6671
Creation 2009-04-04 (Christophe Dunand)
Last sequence changes 2009-04-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: LbiHCMDn
Name LbiHCMDn
Class Hydrolase-CMD fusion (no peroxidase activity)    [Orthogroup: HCMDn001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LbiHCMDn
start..stop
S start..stop
CcinHCMDn 454 5e-155 12..568 4..551
UmHCMDn 302 1e-96 18..566 7..493
CcinHCMDn[P] 212 3e-64 265..568 30..343
AfumCMDn02 119 1e-31 21..205 9..181
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10582060..10582293 234 N° 2 10582347..10582772 426 N° 3 10583012..10583226 215 N° 4 10583269..10583333 65
N° 5 10583355..10583639 285 N° 6 10583664..10584163 500  
join(10582060..10582293,10582347..10582772,10583012..10583226,10583269..10583333 ,10583355..10583639,10583664..10584163)


exon

Literature and cross-references LbiHCMDn
DNA ref. JGI genome:   LG_1 (10582060..10584163)
EST ref. GenBank:   EX806306.1 [5' end]   EX806305.1 [3' end]
Protein sequence: LbiHCMDn
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   574
PWM (Da):   %s   61428.57  
PI (pH):   %s   5.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVKPTDYEIGPSRIVSGRYPPPGTNTYADAIRERRGARGITALDGNLLHFPAMAGGYNTLLGAIRDKGSLSVDIRELMILRVAALNNAAFEWIQHEAVGRKGGLTNGQLYIIRDVDTPLPLMEGILTPLQAAAVAFTDAITKDVSVPKQTSTELMNQLRRSLKEADAATEEEELKAKTEDLYVEATMVVAAYNMVSRFLVATDVGGLSDLEVPWPVDVEEQLIPTPSYPSLPFSNSNSTHSPASGTSTTQTHNLHIRTITTSPTAPWLVFANSLLTDKEMWNLVLPFFLDGGTGYNILLHSQRGHGLSELPSHERRTTIPLLAADIHHLISTIIGGRAQSEDGQSHSPEVHIIGVSQGGAAALAYYALYGSSATEGVKVKSIVACDTAPRTPPGNEVAWENRISIALDMYARKVGMPKLAKVTLRRWFPAGSGLPSGGGSPFLEAREAWLGDMVSRTPVAGFVAGARALGSYDIALPPPPSPLPPSPLHAEAPVKESESDVTRVLLLAGSLDGAGKVGKELKAFAEHWADKARQEVVEYAEVEMAGHLPMVDMPERFCKVLGAWLVGEGGLGE

Retrieve as FASTA  
Remarks Complete sequence from genomic and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCAAGCCAACTGACTACGAAATTGGGCCCTCGCGAATCGTATCGGGGCGCTATCCGCCTCCAGGGACGAACACCTACGCCGATGCCATACGCGAACGACGCGGCGCACGCGGGATC
ACCGCACTCGATGGCAACTTGCTTCACTTTCCTGCCATGGCTGGCGGGTACAACACCTTATTGGGTGCCATTAGGGATAAAGGCTCATTGAGCGTCGACATCCGAGAGCTTATG
GTACGT
GAACGCGGATGACGATGGGAACCGGTGGCTTTTGATGCCTAGTGCAGATCCTACGCGTTGCTGCTTTGAACAACGCAGCCTTCGAGTGGATCCAGCATGAAGCCGTTGGTCGAAAAGGTG
GACTGACCAATGGGCAGCTGTACATCATCCGCGATGTTGATACGCCGTTACCACTCATGGAGGGCATACTCACTCCCCTCCAAGCCGCTGCAGTCGCGTTTACGGATGCAATCACCAAAG
ACGTGTCAGTGCCGAAGCAGACGTCCACAGAGCTCATGAATCAGCTACGGCGTTCGTTAAAGGAAGCCGATGCAGCAACGGAGGAAGAAGAATTGAAGGCAAAGACGGAGGATTTGTACG
TGGAAGCGACGATGGTGGTCGCTGCGTATAATATGGTATCGAGGTTCTTAGTGGCCACCGATGTAGGCGGTCTTTCTGATTTGGAGGTTCCGTGGCCTGTCGATGTTGAGGAA
GTGGGTA
CTTGTTCTCCTCTTTTTCTGCCCCGTGGCCATCTCGTCATGGTTTTTCTTTTCTTTCTCAATCCAAGATCAAAATTCTGAACTGACTGCTTTGCCTTTCCGCCTCCCTTTCTTACAACCC
GGATGTCTATTTCAACCGAATTTTCTTACTCAAACTCCGGAAACTCGCCCCCCCCCCTTGCGCTCCCCTTTATTGTCTCCAACCGTCTTTTATCCCGCGTCTCTTCCAATAGCAATTGAT
ACCCACCCCATCATACCCCTCCCTTCCTTTTTCCAACTCTAACTCAACCCATTCTCCTGCATCTGGAACGAGCACCACACAAACCCACAACCTCCACATCCGTACCATAACAACCTCACC
TACCGCCCCATGGCTCGTCTTTGCCAACTCCCTCCTCACAGACAAGGAGATGTGGAATTTGGTGCTACCATTCTTCCTCGATGGAGG
GTTTACCGCTCTGCCCGACGATGGACCTTGTCA
GCAGAACAGAACAGGTTATAATATACTCTTACACTCCCAACGCGGACATGGGTTATCCGAGTTGCCCTCTCAACGTCCTCTCGATGGGGGGGAAGACGAAAGACGAACAACCATTCCGCT
TCTAGCAGCTGACATTCATCACCTTATATCAACCATTATCGGTGGTCGAGCTCAAAGCGAGGATGGCCAATCTCATTCCCCAGAAGTTCACATCATTGGCGTCTCCCAAGGTGGCGCAGC
TGCACTTGCTTATTACGCCCTTTACGGCTCCTCTGCCACTGAAGGAGTAAAAGTGAAGAGCATCGTTGCATGCGATACCGCGCCACGGACGCCACCAGGAAACGAAGTGGCATGGGAGAA
CCGAATAAGCATAGCCCTGG
GTTATCCTGTCGAGGGGGAAGGAGACATGTACGCTCGAAAGGTCGGCATGCCCAAGCTTGCAAAGGTCACGCTACGCAGGTGGTTCCCTGCTGGCTCGGG
TCTTCCTTCAGGAGGTGGGAGTCCGTTCTTGGAAGCGAGAGAAGCATGGTTGGGGGATATGGTTTCCCGTACGCCAGTAGCAGGGTTCGTAGCGGGTGCACGCGCATTAGGGTCATACGA
CATCGCCCTGCCTCCTCCTCCCTCTCCTCTTCCTCCCTCCCCTCTTCACGCAGAAGCTCCAGTAAAAGAATCGGAATCGGACGTCACCCGCGTGTTGCTCCTTGCAGGCTCTCTCGACGG
AGCCGGGAAAGTTGGCAAGGAACTCAAGGCTTTCGCAGAGCATTGGGCTGATAAAGCTAGGCAGGAGGTGGTGGAATATGCTGAAGTTGAGATGGCGGGGCACTTGCCGATGGTTGATAT
GCCTGAGAGGTTTTGTAAGGTATTGGGGGCGTGGTTGGTGGGGGAGGGTGGCTTGGGAGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCAAGCCAACTGACTACGAAATTGGGCCCTCGCGAATCGTATCGGGGCGCTATCCGCCTCCAGGGACGAACACCTACGCCGATGCCATACGCGAACGACGCGGCGCACGCGGGATC
ACCGCACTCGATGGCAACTTGCTTCACTTTCCTGCCATGGCTGGCGGGTACAACACCTTATTGGGTGCCATTAGGGATAAAGGCTCATTGAGCGTCGACATCCGAGAGCTTATG
ATCCTA
CGCGTTGCTGCTTTGAACAACGCAGCCTTCGAGTGGATCCAGCATGAAGCCGTTGGTCGAAAAGGTGGACTGACCAATGGGCAGCTGTACATCATCCGCGATGTTGATACGCCGTTACCA
CTCATGGAGGGCATACTCACTCCCCTCCAAGCCGCTGCAGTCGCGTTTACGGATGCAATCACCAAAGACGTGTCAGTGCCGAAGCAGACGTCCACAGAGCTCATGAATCAGCTACGGCGT
TCGTTAAAGGAAGCCGATGCAGCAACGGAGGAAGAAGAATTGAAGGCAAAGACGGAGGATTTGTACGTGGAAGCGACGATGGTGGTCGCTGCGTATAATATGGTATCGAGGTTCTTAGTG
GCCACCGATGTAGGCGGTCTTTCTGATTTGGAGGTTCCGTGGCCTGTCGATGTTGAGGAA
CAATTGATACCCACCCCATCATACCCCTCCCTTCCTTTTTCCAACTCTAACTCAACCCAT
TCTCCTGCATCTGGAACGAGCACCACACAAACCCACAACCTCCACATCCGTACCATAACAACCTCACCTACCGCCCCATGGCTCGTCTTTGCCAACTCCCTCCTCACAGACAAGGAGATG
TGGAATTTGGTGCTACCATTCTTCCTCGATGGAGG
AACAGGTTATAATATACTCTTACACTCCCAACGCGGACATGGGTTATCCGAGTTGCCCTCTCAACACGAAAGACGAACAACCATT
CCGCTTCTAGCAGCTGACATTCATCACCTTATATCAACCATTATCGGTGGTCGAGCTCAAAGCGAGGATGGCCAATCTCATTCCCCAGAAGTTCACATCATTGGCGTCTCCCAAGGTGGC
GCAGCTGCACTTGCTTATTACGCCCTTTACGGCTCCTCTGCCACTGAAGGAGTAAAAGTGAAGAGCATCGTTGCATGCGATACCGCGCCACGGACGCCACCAGGAAACGAAGTGGCATGG
GAGAACCGAATAAGCATAGCCCTGG
ACATGTACGCTCGAAAGGTCGGCATGCCCAAGCTTGCAAAGGTCACGCTACGCAGGTGGTTCCCTGCTGGCTCGGGTCTTCCTTCAGGAGGTGGG
AGTCCGTTCTTGGAAGCGAGAGAAGCATGGTTGGGGGATATGGTTTCCCGTACGCCAGTAGCAGGGTTCGTAGCGGGTGCACGCGCATTAGGGTCATACGACATCGCCCTGCCTCCTCCT
CCCTCTCCTCTTCCTCCCTCCCCTCTTCACGCAGAAGCTCCAGTAAAAGAATCGGAATCGGACGTCACCCGCGTGTTGCTCCTTGCAGGCTCTCTCGACGGAGCCGGGAAAGTTGGCAAG
GAACTCAAGGCTTTCGCAGAGCATTGGGCTGATAAAGCTAGGCAGGAGGTGGTGGAATATGCTGAAGTTGAGATGGCGGGGCACTTGCCGATGGTTGATATGCCTGAGAGGTTTTGTAAG
GTATTGGGGGCGTGGTTGGTGGGGGAGGGTGGCTTGGGAGAGTAA

Retrieve as FASTA