Entry information : ZmPrx116 (GRMZM2G035506)
Entry ID 6676
Creation 2009-04-09 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Christophe Dunand)
Peroxidase information: ZmPrx116 (GRMZM2G035506)
Name (synonym) ZmPrx116 (GRMZM2G035506)
Class Class III peroxidase    [Orthogroup: Prx221]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx116
start..stop
S start..stop
SiPrx80 524 0 1..322 1..320
SbPrx77 511 0 2..322 3..323
SiPrx82 471 5e-169 2..322 3..321
SiPrx77 458 7e-164 2..322 3..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 145216469..145216684 216 N° 2 145216170..145216364 195 N° 3 145215497..145216054 558  
complement(join(145215497..145216054,145216170..145216364,145216469..145216684))


exon

Literature and cross-references ZmPrx116 (GRMZM2G035506)
DNA ref. GenBank:   AC201905.4 (119167..117973)
Protein sequence: ZmPrx116 (GRMZM2G035506)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (297)
PWM (Da):   %s   33660.66 (31122.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.96 (6.88) Peptide Signal:   %s   cut: 26 range:26-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSTTGHCIFLALLLLLASTACYGQLSTSFYSTSCPALESTVRSVVSSAVASNRRMGASLVRLFFHDCFVQGCDASILLDDVPGSFVGEKTAGPNANSVLGYDVINSIKTAVEANCPGVVSCADIVALAARDGTVLLGGPSWNVPLGRHDSTTASLSQANSDLPSPASSLSTLIAKFGNKGLSPTDMTALSGAHSVGFAQCRNYRNRIYNDADINQQFAKLLRTNCSATQGASDTNLAPLDVATQLSFDNAYYGNLLKKKGLLHSDQELFNGGSQDALVQNYSSNANFFFADFVTAMIKMGNINPLNGTAGQIRAKCSVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTCCACGACCGGCCATTGCATATTCCTTGCACTTCTGCTGCTTCTCGCTTCCACGGCCTGCTATGGCCAGCTCTCGACGTCGTTCTACTCCACCAGCTGCCCGGCGCTGGAG
TCCACAGTGCGATCCGTCGTGAGTAGCGCCGTCGCCAGCAACCGCAGGATGGGCGCCTCTCTTGTCCGCCTCTTCTTCCACGACTGCTTCGTCCAG
GTAGGTACAAACGAGAAGGTGTGG
TATTATACATTATTGCCAGCTCAATCCCATAATGTACTGGACGTTTTATTACGTACGTACCGTACGTACGTGATGCACAGGGCTGCGACGCCTCCATTCTTCTGGACGACGTGCCGGGCA
GCTTCGTCGGCGAGAAAACCGCTGGCCCGAACGCCAACTCCGTCCTCGGCTACGATGTCATCAACAGCATAAAGACAGCCGTCGAGGCCAACTGCCCCGGCGTCGTCTCCTGCGCCGACA
TCGTCGCCCTCGCCGCGCGCGACGGCACCGTACTG
GTAGGTATATACAAGAGCCGGGCCGGCGGCAAGCCACATCAATTAATTAACTTCTCAACGAAATTCAATTATATATATGCTATCG
ATCGATTTCATCGACTATCGTTGATTTCAGCTCGGTGGACCGTCCTGGAACGTACCTCTCGGCCGGCACGACTCGACGACGGCGAGCCTGAGCCAAGCCAACAGCGACCTCCCCTCGCCG
GCGTCCAGCCTCAGCACGCTCATCGCCAAGTTCGGGAACAAGGGCCTGAGCCCGACGGACATGACGGCGCTCTCCGGCGCGCACAGCGTCGGCTTCGCGCAGTGCCGGAACTACCGCAAC
CGCATCTACAACGACGCCGACATCAACCAGCAGTTCGCCAAGCTGCTCAGGACCAACTGCTCGGCCACGCAGGGCGCAAGCGACACCAACCTAGCGCCGCTCGACGTGGCCACGCAGCTC
AGCTTCGACAACGCCTACTACGGGAACCTGCTCAAGAAGAAAGGCCTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGCTCGCAGGACGCGCTGGTGCAGAACTACAGCTCCAACGCC
AACTTCTTCTTCGCTGACTTCGTCACGGCCATGATCAAGATGGGGAATATCAACCCGCTCAACGGAACCGCCGGCCAGATCAGGGCCAAATGCAGTGTGGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTCCACGACCGGCCATTGCATATTCCTTGCACTTCTGCTGCTTCTCGCTTCCACGGCCTGCTATGGCCAGCTCTCGACGTCGTTCTACTCCACCAGCTGCCCGGCGCTGGAG
TCCACAGTGCGATCCGTCGTGAGTAGCGCCGTCGCCAGCAACCGCAGGATGGGCGCCTCTCTTGTCCGCCTCTTCTTCCACGACTGCTTCGTCCAG
GGCTGCGACGCCTCCATTCTTCTG
GACGACGTGCCGGGCAGCTTCGTCGGCGAGAAAACCGCTGGCCCGAACGCCAACTCCGTCCTCGGCTACGATGTCATCAACAGCATAAAGACAGCCGTCGAGGCCAACTGCCCCGGCGTC
GTCTCCTGCGCCGACATCGTCGCCCTCGCCGCGCGCGACGGCACCGTACTG
CTCGGTGGACCGTCCTGGAACGTACCTCTCGGCCGGCACGACTCGACGACGGCGAGCCTGAGCCAAGCC
AACAGCGACCTCCCCTCGCCGGCGTCCAGCCTCAGCACGCTCATCGCCAAGTTCGGGAACAAGGGCCTGAGCCCGACGGACATGACGGCGCTCTCCGGCGCGCACAGCGTCGGCTTCGCG
CAGTGCCGGAACTACCGCAACCGCATCTACAACGACGCCGACATCAACCAGCAGTTCGCCAAGCTGCTCAGGACCAACTGCTCGGCCACGCAGGGCGCAAGCGACACCAACCTAGCGCCG
CTCGACGTGGCCACGCAGCTCAGCTTCGACAACGCCTACTACGGGAACCTGCTCAAGAAGAAAGGCCTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGCTCGCAGGACGCGCTGGTG
CAGAACTACAGCTCCAACGCCAACTTCTTCTTCGCTGACTTCGTCACGGCCATGATCAAGATGGGGAATATCAACCCGCTCAACGGAACCGCCGGCCAGATCAGGGCCAAATGCAGTGTG
GTTAACTAA

Retrieve as FASTA