Entry information : ZmPrx120 (Peroxidase 52)
Entry ID 6680
Creation 2009-04-09 (Christophe Dunand)
Last sequence changes 2009-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx120 (Peroxidase 52)
Name (synonym) ZmPrx120 (Peroxidase 52)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx120
start..stop
S start..stop
SofPrx11 587 0 5..321 1..319
SbPrx18 556 0 13..321 19..327
SiPrx165 550 0 9..321 1..313
OsPrx40 518 0 16..320 15..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 130883872..130884072 201 N° 2 130883564..130883758 195 N° 3 130882822..130883391 570  
complement(join(130882822..130883391,130883564..130883758,130883872..130884072))


exon

Literature and cross-references ZmPrx120 (Peroxidase 52)
Literature Collura,K., Wissotski,M., Campos,D., Kudrna,D., Golser,W., Ashely ,E., Haller,K., Wing,R., Soderlund,C., Walbot,V. and Yu,Y. Maize Full-length cDNA Project.
Protein ref. UniProtKB:   B6SRR3
DNA ref. GenBank:   AC211681.4 (29195..27945)
mRNA ref. GenBank:   EU955428
EST ref. GenBank:   EE181627.2 [5' end]   EC872383.1 [3' end]
Cluster/Prediction ref. UniGene:   Zm.127107
Protein sequence: ZmPrx120 (Peroxidase 52)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (301)
PWM (Da):   %s   33465.73 (31678.8)  
PI (pH):   %s   6.5 (6.50) Peptide Signal:   %s   cut: 21 range:21-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAAACVAVALALLATTSSAQLDPHFYDKACPAALPTIKRLVEEAVAAEPRMGASLLRLHFHDCFVNGCDGSILLDDTPFFTGETMAAPNANSVRGFDVIDRIKGAVNAACRGNVVSCADVVAIAARDSVVALGGPSYDVPLGRRDARTASQAAANSSIPAPTFGIDRLASNFASHGLSLQDLVALSGAHTLGFSRCTNFRDRLYNETATLDGSLAASLRAACPRAAGTGDDSLAPLDPTPARFDAAYFASLLRNRGVLHSDQQLFAGGPGVADALVRLYAADTDAFRRDFADAMVRMGSLSPLTGSNGEIRYNCRKVNYS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, introns 1 and 2) and 7 ESTs. Cultivar="B73". Also found in AC225340.1 and AC155405.2.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCGGCGGCGTGCGTCGCCGTCGCGTTGGCTCTGTTGGCCACGACCAGCAGCGCGCAGCTGGACCCGCACTTCTACGACAAGGCGTGCCCGGCGGCGCTCCCCACCATCAAGAGG
CTCGTGGAGGAGGCTGTGGCCGCGGAGCCCCGCATGGGCGCGTCGCTGCTGCGGCTGCACTTCCACGACTGCTTCGTCAAC
GTACGTACGCAGATGCATGCGTGCATAATTCGACTTCGG
TTCTCTCTCCGATATCATCTGTGTGTTCGGCCTCACCATCTCTTCTGCGTTTCCATTGGTGCTTGTTGGTTCAGGGGTGCGACGGGTCCATCCTGCTGGACGACACGCCCTTCTTCACCG
GCGAGACGATGGCCGCGCCGAACGCCAACTCCGTCCGCGGCTTCGACGTGATCGACCGCATTAAGGGCGCCGTCAACGCCGCCTGCAGGGGCAACGTGGTCTCCTGCGCCGACGTCGTCG
CCATCGCGGCACGCGACTCCGTCGTCGCG
GTTCGTTCGATTCATCCATTCGCCTCCATCTATCGTCTTGTCGCACGCACGAAAACCTTTACCCGTCGTCCATGCACGCAACGCAACGTAA
ACACGGCAGAGAGCTAGTGCAGCTAATAATAACTAACTAACTGAACTAATTAGTTGCGCATGCATGCATACGTACGTGCAGCTGGGAGGGCCGTCGTACGACGTGCCGCTGGGCCGCCGG
GACGCGCGGACGGCGAGCCAGGCGGCGGCGAACAGCAGCATCCCGGCGCCGACCTTCGGCATCGACCGCCTGGCCTCCAACTTCGCGTCGCACGGCCTCTCCCTGCAGGACCTCGTCGCG
CTCTCGGGAGCGCACACGCTGGGGTTCTCCCGCTGCACCAACTTCCGAGACCGCCTCTACAACGAGACCGCCACCCTGGACGGCTCCCTCGCCGCCTCGCTCCGGGCCGCGTGCCCTCGG
GCCGCCGGCACCGGCGACGACAGCCTCGCGCCGCTCGACCCCACGCCCGCGCGGTTCGACGCCGCCTACTTCGCCTCGCTGCTGCGGAACCGGGGAGTGCTGCACTCGGACCAGCAGCTG
TTCGCCGGCGGCCCCGGCGTCGCGGACGCCCTCGTGAGGTTGTACGCCGCCGACACCGACGCCTTCAGGAGGGACTTCGCGGACGCCATGGTGAGGATGGGCAGCCTCAGCCCGCTCACC
GGGAGCAACGGCGAGATTCGCTACAACTGCCGGAAGGTGAACTACTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCGGCGGCGTGCGTCGCCGTCGCGTTGGCTCTGTTGGCCACGACCAGCAGCGCGCAGCTGGACCCGCACTTCTACGACAAGGCGTGCCCGGCGGCGCTCCCCACCATCAAGAGG
CTCGTGGAGGAGGCTGTGGCCGCGGAGCCCCGCATGGGCGCGTCGCTGCTGCGGCTGCACTTCCACGACTGCTTCGTCAAC
GGGTGCGACGGGTCCATCCTGCTGGACGACACGCCCTTC
TTCACCGGCGAGACGATGGCCGCGCCGAACGCCAACTCCGTCCGCGGCTTCGACGTGATCGACCGCATTAAGGGCGCCGTCAACGCCGCCTGCAGGGGCAACGTGGTCTCCTGCGCCGAC
GTCGTCGCCATCGCGGCACGCGACTCCGTCGTCGCG
CTGGGAGGGCCGTCGTACGACGTGCCGCTGGGCCGCCGGGACGCGCGGACGGCGAGCCAGGCGGCGGCGAACAGCAGCATCCCG
GCGCCGACCTTCGGCATCGACCGCCTGGCCTCCAACTTCGCGTCGCACGGCCTCTCCCTGCAGGACCTCGTCGCGCTCTCGGGAGCGCACACGCTGGGGTTCTCCCGCTGCACCAACTTC
CGAGACCGCCTCTACAACGAGACCGCCACCCTGGACGGCTCCCTCGCCGCCTCGCTCCGGGCCGCGTGCCCTCGGGCCGCCGGCACCGGCGACGACAGCCTCGCGCCGCTCGACCCCACG
CCCGCGCGGTTCGACGCCGCCTACTTCGCCTCGCTGCTGCGGAACCGGGGAGTGCTGCACTCGGACCAGCAGCTGTTCGCCGGCGGCCCCGGCGTCGCGGACGCCCTCGTGAGGTTGTAC
GCCGCCGACACCGACGCCTTCAGGAGGGACTTCGCGGACGCCATGGTGAGGATGGGCAGCCTCAGCCCGCTCACCGGGAGCAACGGCGAGATTCGCTACAACTGCCGGAAGGTGAACTAC
TCTTGA

Retrieve as FASTA