Entry information : ZmPrx134 (Peroxidase 16)
Entry ID 6696
Creation 2009-04-11 (Christophe Dunand)
Last sequence changes 2009-04-11 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx134 (Peroxidase 16)
Name (synonym) ZmPrx134 (Peroxidase 16)
Class Class III peroxidase    [Orthogroup: Prx124]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx134
start..stop
S start..stop
SbPrx140 550 0 1..320 1..317
SiPrx44 504 0 1..320 2..320
OsPrx93 442 1e-157 1..320 1..314
OsPrx92 441 2e-157 1..320 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53199703..53199924 222 N° 2 53199421..53199618 198 N° 3 53199171..53199330 160 N° 4 53198593..53198981 389
complement(join(53198593..53198981,53199171..53199330,53199421..53199618,5319970 3..53199924))


exon

Literature and cross-references ZmPrx134 (Peroxidase 16)
Protein ref. UniProtKB:   B6U531
DNA ref. GenBank:   AC196709.3 (127301..128632)
mRNA ref. GenBank:   EU944789   EU972346
Cluster/Prediction ref. UniGene:   Zm.127204
Protein sequence: ZmPrx134 (Peroxidase 16)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (297)
PWM (Da):   %s   33806.81 (31181.3) Transmb domain:   %s   i7-24o
PI (pH):   %s   5.12 (4.81) Peptide Signal:   %s   cut: 26 range:26-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRRLQFLAAAAAAIFLLALPLMATAQPKLRPDYYAGVCPNLESIVRGAVRQSVALSPLAAPATLRLFFHDCAVRGCDASVMLIDPAGGDEWRSPDGVMLKPEGFSTVMSAKAAVDSDPQCRNMVSCADILALAARDSVFLSGGPDYEVELGRFDGRVSSGGSVVVPHGTFDLDQLNAFFSSLGLSQTDMIALSGGHTIGAASCGSFAYRVGADPAMDPALAQQVLARCPGGGPAGFAFLDATTPLRFDNEYYRNLLGGMGILASDQVLYADPRSRGAVERYAADQAAFFGDFAAAMTRLGRVGVRTAADGEIRRDCRFPNPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 9 ESTs. Also found in AC191516.3.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCGCCTCCAGTTCCTGGCCGCCGCCGCCGCCGCCATCTTCCTCCTCGCGCTTCCGCTGATGGCGACGGCCCAGCCGAAGCTGAGGCCGGACTACTACGCCGGCGTCTGCCCGAAC
CTCGAGAGCATTGTCCGCGGCGCCGTGCGGCAGTCCGTGGCGCTCTCGCCGCTCGCCGCCCCGGCCACGCTCCGGCTCTTCTTCCACGACTGCGCGGTCAGG
GTACGTGCGTGCGATTAT
AATACGGATGATGCCGATGAGAGAACTGATGCCGTGCCGGTGCCACCACTCTCTTGTGAATTTAAGGGCTGCGACGCGTCGGTGATGCTCATCGACCCGGCCGGCGGCGACGAGTGGCGG
AGCCCCGACGGCGTGATGCTGAAGCCGGAAGGGTTCAGCACGGTGATGAGCGCCAAGGCGGCGGTGGACAGCGACCCGCAGTGCCGGAACATGGTGTCCTGCGCCGACATCTTGGCCCTC
GCCGCCAGGGACTCCGTGTTCCTG
GTAACTACGCGAATTTGCTCGGTCGCTTTCGTTGTCGAGTTGATCGTGTGACCGTCTCTCTCGTGCCATCGTGCGTCGTACGGCCCGCAGAGCGGA
GGGCCAGACTACGAAGTGGAGCTGGGCAGGTTCGACGGCAGGGTGTCGAGTGGTGGCAGCGTCGTGGTTCCTCATGGCACGTTCGACCTCGACCAGCTCAACGCCTTCTTCTCCAGCCTC
GGTCTCTCCCAGACCGACATGATCGCACTGTCAG
GTACGTGTCAACGCGCGCGTGTCCATATATAAATGCGTCAGCTAGTAGAACACGCCAAGAGCATGCATACCGCTGCTACTGCTACT
GCGAACGAACACCTGAAGTGCAGGTGCAGCCGTGAAGCCATGCCCGTCGCTAACGGCCGTTCTTGCGCGTGGCATGCACCACTGCGTGCAACTGTGCAAGCAGGGGGTCACACGATCGGC
GCGGCGTCGTGCGGCTCCTTCGCGTACCGGGTGGGCGCGGATCCGGCCATGGACCCGGCGCTCGCGCAGCAGGTCCTGGCGCGCTGCCCGGGGGGCGGGCCAGCCGGGTTCGCGTTCCTG
GACGCCACGACGCCGCTGCGGTTCGACAACGAGTACTACCGGAACCTGCTCGGCGGGATGGGGATCCTGGCCTCCGACCAGGTGCTGTACGCCGACCCGAGGTCCCGCGGCGCCGTCGAG
CGCTACGCCGCGGACCAGGCCGCCTTCTTCGGGGACTTTGCCGCGGCAATGACGAGGCTCGGCAGGGTCGGGGTCCGCACGGCGGCCGACGGCGAGATACGCCGCGACTGCAGGTTCCCC
AACCCCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCGCCTCCAGTTCCTGGCCGCCGCCGCCGCCGCCATCTTCCTCCTCGCGCTTCCGCTGATGGCGACGGCCCAGCCGAAGCTGAGGCCGGACTACTACGCCGGCGTCTGCCCGAAC
CTCGAGAGCATTGTCCGCGGCGCCGTGCGGCAGTCCGTGGCGCTCTCGCCGCTCGCCGCCCCGGCCACGCTCCGGCTCTTCTTCCACGACTGCGCGGTCAGG
GGCTGCGACGCGTCGGTG
ATGCTCATCGACCCGGCCGGCGGCGACGAGTGGCGGAGCCCCGACGGCGTGATGCTGAAGCCGGAAGGGTTCAGCACGGTGATGAGCGCCAAGGCGGCGGTGGACAGCGACCCGCAGTGC
CGGAACATGGTGTCCTGCGCCGACATCTTGGCCCTCGCCGCCAGGGACTCCGTGTTCCTG
AGCGGAGGGCCAGACTACGAAGTGGAGCTGGGCAGGTTCGACGGCAGGGTGTCGAGTGGT
GGCAGCGTCGTGGTTCCTCATGGCACGTTCGACCTCGACCAGCTCAACGCCTTCTTCTCCAGCCTCGGTCTCTCCCAGACCGACATGATCGCACTGTCAG
GGGGTCACACGATCGGCGCG
GCGTCGTGCGGCTCCTTCGCGTACCGGGTGGGCGCGGATCCGGCCATGGACCCGGCGCTCGCGCAGCAGGTCCTGGCGCGCTGCCCGGGGGGCGGGCCAGCCGGGTTCGCGTTCCTGGAC
GCCACGACGCCGCTGCGGTTCGACAACGAGTACTACCGGAACCTGCTCGGCGGGATGGGGATCCTGGCCTCCGACCAGGTGCTGTACGCCGACCCGAGGTCCCGCGGCGCCGTCGAGCGC
TACGCCGCGGACCAGGCCGCCTTCTTCGGGGACTTTGCCGCGGCAATGACGAGGCTCGGCAGGGTCGGGGTCCGCACGGCGGCCGACGGCGAGATACGCCGCGACTGCAGGTTCCCCAAC
CCCAACTGA

Retrieve as FASTA