Entry information : ZmPrx136
Entry ID 6698
Creation 2009-04-11 (Christophe Dunand)
Last sequence changes 2009-04-11 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx136
Name ZmPrx136
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx136
start..stop
S start..stop
SbPrx82 522 0 29..330 31..330
SiPrx75 506 0 33..328 29..322
OsPrx32 462 1e-165 14..328 13..322
BdiPrx114 421 3e-149 30..330 35..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 158822364..158822594 231 N° 2 158822699..158822887 189 N° 3 158823377..158823949 573  
join(158822364..158822594,158822699..158822887,158823377..158823949)


exon

Literature and cross-references ZmPrx136
DNA ref. GenBank:   AC198130.3 (163404..164989)
Cluster/Prediction ref. UniGene:   Zm.34268
Protein sequence: ZmPrx136
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (308)
PWM (Da):   %s   34367.59 (32298.4) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.22 (8.41) Peptide Signal:   %s   cut: 32 range:23-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAAPPAAEAALLLLLALLALAAVALRRGDALSLDLYDVTCPEVEAAVTAAVRQAMANDRTVAAGLLRMHFHDCFVRGCDGSVLLDSTATVTAEKDGPPNASLHAFYVIDNAKRAVEALCPGVVSCADILALAARDAVALSGGPWWVVPVGRRDGRVSLANETTAALPGPTASFDQLKQAFHGRGLSTKDLVALSGAHTLGFAHCSSFQNRILRAQQGVAAADDPSLSPSFAAALRRACPANNTVRAAGSALDATSAAFDNTYYRMLQAGRGLLSSDEALLTHPKTRAFVALYAASQEAFFRAFTKSMLRMAGLNGGQEVRANCRRVNPS*

Retrieve as FASTA  
Remarks Complete Sequence from genomic (chromo 5, introns 1 and 2) and 5 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGGCGCCTCCTGCCGCAGAGGCAGCTCTTCTTCTCCTCCTAGCATTACTGGCACTCGCCGCGGTGGCTCTGAGACGCGGCGATGCGCTGAGCCTGGATTTGTACGACGTGACC
TGCCCGGAGGTGGAGGCGGCGGTGACGGCGGCCGTGCGGCAGGCCATGGCCAACGACCGCACAGTGGCGGCCGGACTCCTCCGAATGCATTTCCACGACTGCTTCGTGAGG
GTAATAATT
TCCTCCTCTTATTCTTGTTGTTGAATCTATCATTGCATTATTGGTCTGCTGTCCTCTGAATCCATCCGCCCGCCCGCCCGGCCGGCCGGCAGCAGGGCTGCGACGGCTCCGTTCTCCTGG
ACTCCACGGCCACCGTGACGGCGGAGAAGGACGGCCCGCCCAACGCGTCGCTGCACGCCTTCTACGTCATCGACAACGCCAAGCGTGCCGTGGAGGCCCTCTGCCCCGGCGTCGTCTCCT
GCGCCGACATCCTCGCCCTCGCCGCAAGGGACGCCGTCGCGCTG
GTATGTATATTCTGCTGGAGTGATAGTAGATAGATGATGATGCAATGCAATAGATGCGATCGATCGAGAAGAACGA
TGCTGCGCTTGTTGAGAGATGAGGACGATGCTAGTAGCTAACACGGCAGGTCAGCAGCCTCTCTCATGCATGTTCGGAACGAACGCCCATCCGGAGTCACGTGCTTGCGTCTCTAGCTAC
GACAGCCATGGATACCGCCTGCTGCATCGAGCGAGCTGTCACTTGTGGTGATCACGTGCTCGATGTGTCTCGATCCTCGAGCATAAAGTGCTGCTGGCCGGCTGCCCCGCATCCGCATGC
AAGCAGCAGCAGCAGCAGGGCCTGGTTGTCGTACGTGCACGCATCATGCATACATGATCGGACTATCCTCAACTAGCTAGCAGTAGCACAGTAGTACATTTTTTGTATTATTATCTTTTG
CATTTTGTGCATTAATTAATTACCTCCTGATCGGCCATGCACGTACGATGCAGTCCGGTGGTCCGTGGTGGGTGGTGCCCGTGGGGCGGCGGGACGGGCGCGTGTCCCTGGCCAACGAGA
CCACGGCGGCGCTGCCGGGGCCGACGGCCAGCTTCGACCAGCTGAAGCAGGCGTTCCACGGCCGCGGGCTGTCCACCAAGGACCTGGTGGCGCTGTCGGGCGCCCACACGCTGGGCTTCG
CGCACTGCTCCTCCTTCCAGAACCGCATCCTCCGAGCCCAGCAGGGCGTCGCCGCCGCCGACGACCCTTCCCTCAGCCCCTCCTTCGCCGCCGCCCTTCGCCGTGCGTGCCCCGCCAACA
ACACCGTCCGCGCCGCCGGCTCCGCCCTGGACGCCACCTCCGCGGCCTTCGACAACACCTACTACCGGATGCTGCAGGCCGGCCGGGGCCTGCTCTCCTCCGACGAGGCGCTGCTCACGC
ACCCCAAGACGCGCGCCTTTGTCGCGCTCTACGCCGCGTCGCAGGAGGCATTCTTCAGGGCCTTTACAAAATCCATGCTGCGGATGGCCGGCCTCAACGGAGGCCAAGAGGTGCGAGCCA
ACTGCAGGCGAGTTAACCCATCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGGCGCCTCCTGCCGCAGAGGCAGCTCTTCTTCTCCTCCTAGCATTACTGGCACTCGCCGCGGTGGCTCTGAGACGCGGCGATGCGCTGAGCCTGGATTTGTACGACGTGACC
TGCCCGGAGGTGGAGGCGGCGGTGACGGCGGCCGTGCGGCAGGCCATGGCCAACGACCGCACAGTGGCGGCCGGACTCCTCCGAATGCATTTCCACGACTGCTTCGTGAGG
GGCTGCGAC
GGCTCCGTTCTCCTGGACTCCACGGCCACCGTGACGGCGGAGAAGGACGGCCCGCCCAACGCGTCGCTGCACGCCTTCTACGTCATCGACAACGCCAAGCGTGCCGTGGAGGCCCTCTGC
CCCGGCGTCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCAAGGGACGCCGTCGCGCTG
TCCGGTGGTCCGTGGTGGGTGGTGCCCGTGGGGCGGCGGGACGGGCGCGTGTCCCTGGCC
AACGAGACCACGGCGGCGCTGCCGGGGCCGACGGCCAGCTTCGACCAGCTGAAGCAGGCGTTCCACGGCCGCGGGCTGTCCACCAAGGACCTGGTGGCGCTGTCGGGCGCCCACACGCTG
GGCTTCGCGCACTGCTCCTCCTTCCAGAACCGCATCCTCCGAGCCCAGCAGGGCGTCGCCGCCGCCGACGACCCTTCCCTCAGCCCCTCCTTCGCCGCCGCCCTTCGCCGTGCGTGCCCC
GCCAACAACACCGTCCGCGCCGCCGGCTCCGCCCTGGACGCCACCTCCGCGGCCTTCGACAACACCTACTACCGGATGCTGCAGGCCGGCCGGGGCCTGCTCTCCTCCGACGAGGCGCTG
CTCACGCACCCCAAGACGCGCGCCTTTGTCGCGCTCTACGCCGCGTCGCAGGAGGCATTCTTCAGGGCCTTTACAAAATCCATGCTGCGGATGGCCGGCCTCAACGGAGGCCAAGAGGTG
CGAGCCAACTGCAGGCGAGTTAACCCATCATGA

Retrieve as FASTA