Entry information : ZmPrx137
Entry ID 6699
Creation 2009-04-11 (Christophe Dunand)
Last sequence changes 2013-12-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-12-26 (Christophe Dunand)
Peroxidase information: ZmPrx137
Name ZmPrx137
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx137
start..stop
S start..stop
SbPrx66 667 0 1..372 1..370
SiPrx02 602 0 1..371 1..365
BdiPrx92 583 0 1..369 1..367
HvPrx25 535 0 4..353 5..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 210673250..210673561 312 N° 2 210672902..210673123 222 N° 3 210670732..210671316 585  
complement(join(210670732..210671316,210672902..210673123,210673250..210673561))


exon

Literature and cross-references ZmPrx137
DNA ref. GenBank:   AC230013.2 (18026..14900)
mRNA ref. GenBank:   EU951441.1
Cluster/Prediction ref. UniGene:   Zm.42169
Protein sequence: ZmPrx137
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   373 (338)
PWM (Da):   %s   40007.97 (36287.9)  
PI (pH):   %s   10.17 (9.73) Peptide Signal:   %s   cut: 35 range:35-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSSSRGIRFLVHRRALLLLLLVASSSLVGTSRGREAQPLPAAAATALGSRRSPERHGLALDFYARTCPAVDQIVANVTAAQYRDFPAAGPAVLRLFHHDCFVEGCDASILIAPTADAAAPARPPPPRVERDMEENRNLPQEAFDTVELAKAAVESKCPGIVSCADVLALAARDYVQLVGGPYYAVKKGRKDSKVSLAGKVRGSLPRANSTVDELLRVFAGKGLGAADLVALSGAHTVGFAHCVHVLGRIYDFRGTRRPDPVMDARLVKALRMSCPSSGGSARVVVPFDVSTPFQFDHAYYANLQARLGLLASDQALFLDARTRPLVQDLAANKTRFFQAFVASMDRMGSIRIKKGRKGEVRKVCSQHLFSA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3,introns 1 and 2) and 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCCTCTAGCAGAGGCATCCGCTTCCTCGTCCACCGCCGCGCGCTGCTGCTGCTGCTGCTCGTCGCGTCGTCGTCCCTCGTCGGCACATCGCGTGGCAGGGAGGCGCAGCCGCTG
CCCGCGGCGGCGGCCACGGCCCTCGGCAGCAGGCGGTCGCCGGAGCGGCACGGCCTGGCGCTGGACTTCTACGCCAGGACGTGCCCCGCTGTCGACCAGATCGTCGCCAACGTCACCGCC
GCCCAGTACAGGGACTTCCCCGCCGCCGGACCCGCCGTGCTCCGCCTCTTCCACCACGACTGCTTCGTGGAA
GTACGTAACCGCCCGGAGCTAGCTAGTTACAAGCAAGAGCTGAGCAAC
TGTTTGTGAATTAGTGCATTGCGTTGCGGTCGTTGGTGTCCTCGTGCTGATTTTGATGTGAAATGCACACGCACGCAGGGGTGTGACGCGTCCATTTTGATCGCGCCGACGGCCGACGCG
GCCGCGCCCGCGCGCCCGCCGCCACCCAGGGTGGAGCGCGACATGGAGGAGAACAGGAACCTGCCGCAGGAGGCGTTCGACACGGTGGAGCTCGCCAAGGCTGCCGTGGAGAGCAAGTGC
CCCGGGATCGTCTCCTGCGCCGACGTCCTCGCCCTCGCCGCCCGAGACTACGTCCAGCTG
GTACGTACGTACCTTTACCTACGCACGCAACGCAAGCTGTCTAGCCCATTCATCTCTCTG
GCTTGATTCACGCGGAATAAAAAAAAACGCGGGGGGAGTTTAGCGGTGCGATCAGAGAAGACGGAGCTGGGCCGAAACCGTCTGACCACGTACAGCATTATGCAACCGAAGGCACGAGCA
GAGCCTTGGGTTCCGGCGAGAGAGAGAGAGCGCGCGCGATGTGACTCTAGTGCATCACCGGCTCACCGCGTTTGCAACTGAAACCCAACTGACGACAGTTAAAGTTGGTAGGGGTCCAGG
TACACTACACTGGCAAGTTAGGACCAAAGCGGCGCGAGGCGGCCGGGGACGGGGAAGAAAAGGTTTACCTGCTTTAATCTGGACTGCTTTTGCACCGCATGTGGAAAAAAAGGCGCAACC
GCACATCGTGCCCATGGCCGGGCATGTGTACGTCGTTAGGGACAGGGCTGCGTTTCGCTGTTGGCTTAGCTGCCTAAGCAGGCCAAGCGTCAGGGGCGGTGATGATGATTACGTGACCGT
GAAGGGAAACGAAACCATGCTATCCTTGCCGGACCTGGAATTCAATCGCTGTATCGGTGGTCGGTGATCTGCTCAGCGAACTGCTTCTGCTAATTATGGCGCGTCAGTGTGGCTGCAAAG
CCTGCAACCGTGGCCGCCCATCATGTTGCATATACGAGTAGGAGTAGTAGTAGCCAGTAGGTTTTAATTTGATTTGCTTAAACGTTTGCTTCGATCTGAGACGAATTAGCACCATCGTCC
ATCAGTCGCTTTTACGTAACGGCAATTTTGCCTGAACCGTTTCTGCCTTTCCGAATTATAGTGTCTGTACGATTTCCTAATATAGCTAGCTAGGAAGACAAAGTGACAGCCTCAACGTCT
AATATCAGTTGAGTTAGGCCTTATTCGTTTCTCCAAAAATACACCATGAATCGTTCTAGGTGATCAAAATTTATACAAACTAAAGAAATAATCCAAGCTAGGAACGGTTATGTCCACCGT
TCTGGGAAAACCGAACGGCCCCTTAAGCTAATCTAATCTTGGGATTCGGCACTCCTTGTCCTGGCTTGGATCTTATGGCCACGAGGCACCACAACTGAAGGCCAGCTGATTTGGTGCTGC
AATGAGAGTAATTTAGGGCCACATGGGCGTGTTTTATAAGTGCGTCAGGTGACACTTGACATGTGGTCGTCTATGACATGACAGCCTCTGAGCGAGTCAAGTGTCGTGTTCTTCCCTCCC
CCAGCAATAGTCAAGCGTCCAACCTGGCGCTGCCTTTGTTGCCTAGTACCACGGTCGCCCATCCTTCTCCTCTCCTGCATCTTTCTGGACCACGCTGGCTGGCTGGCTTGCTAGAAACGG
CCGAAAGTCTACGGCTCATAATTTTTTCTTTTAAACTTTTAGGACAACTTTATCCATTCATGCTTTCTTTCTTTCTTTTTTTATTACTTTCAGCCTATATAAGCATTCGGCTGAGAAACT
CTCAAATGGCCCTAATGGGATCGGGCCCAGCCCAACAGTAGTGGCCCATCACATGCAACTTTTTGACCTTTTTCTGTTTGCGCAGGTGGGTGGGCCGTACTACGCGGTGAAGAAGGGCCG
GAAGGACAGCAAGGTGTCCCTGGCGGGGAAGGTCCGCGGCAGCCTGCCGCGGGCCAACTCGACGGTGGACGAGCTCCTGCGCGTGTTCGCGGGCAAGGGCCTGGGCGCGGCGGACCTGGT
GGCGCTCTCCGGCGCGCACACCGTCGGGTTCGCGCACTGCGTCCACGTGCTGGGCCGCATCTACGACTTCCGCGGCACGCGGCGGCCGGACCCGGTCATGGACGCCCGCCTCGTGAAGGC
GCTCCGCATGTCGTGCCCGTCGTCGGGCGGCAGCGCCCGCGTCGTGGTGCCCTTCGACGTCAGCACGCCCTTCCAGTTCGACCACGCCTACTACGCCAACCTGCAGGCCAGGCTGGGCCT
GCTGGCCTCCGACCAGGCGCTGTTCCTGGACGCGCGCACCAGGCCGCTCGTGCAGGACCTCGCCGCCAACAAGACCCGCTTCTTCCAGGCGTTCGTGGCCAGCATGGACCGGATGGGCTC
CATCCGGATCAAGAAGGGGAGGAAAGGAGAGGTCAGGAAAGTCTGTAGCCAGCACCTGTTTTCAGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCCTCTAGCAGAGGCATCCGCTTCCTCGTCCACCGCCGCGCGCTGCTGCTGCTGCTGCTCGTCGCGTCGTCGTCCCTCGTCGGCACATCGCGTGGCAGGGAGGCGCAGCCGCTG
CCCGCGGCGGCGGCCACGGCCCTCGGCAGCAGGCGGTCGCCGGAGCGGCACGGCCTGGCGCTGGACTTCTACGCCAGGACGTGCCCCGCTGTCGACCAGATCGTCGCCAACGTCACCGCC
GCCCAGTACAGGGACTTCCCCGCCGCCGGACCCGCCGTGCTCCGCCTCTTCCACCACGACTGCTTCGTGGAA
GGGTGTGACGCGTCCATTTTGATCGCGCCGACGGCCGACGCGGCCGCG
CCCGCGCGCCCGCCGCCACCCAGGGTGGAGCGCGACATGGAGGAGAACAGGAACCTGCCGCAGGAGGCGTTCGACACGGTGGAGCTCGCCAAGGCTGCCGTGGAGAGCAAGTGCCCCGGG
ATCGTCTCCTGCGCCGACGTCCTCGCCCTCGCCGCCCGAGACTACGTCCAGCTG
GTGGGTGGGCCGTACTACGCGGTGAAGAAGGGCCGGAAGGACAGCAAGGTGTCCCTGGCGGGGAAG
GTCCGCGGCAGCCTGCCGCGGGCCAACTCGACGGTGGACGAGCTCCTGCGCGTGTTCGCGGGCAAGGGCCTGGGCGCGGCGGACCTGGTGGCGCTCTCCGGCGCGCACACCGTCGGGTTC
GCGCACTGCGTCCACGTGCTGGGCCGCATCTACGACTTCCGCGGCACGCGGCGGCCGGACCCGGTCATGGACGCCCGCCTCGTGAAGGCGCTCCGCATGTCGTGCCCGTCGTCGGGCGGC
AGCGCCCGCGTCGTGGTGCCCTTCGACGTCAGCACGCCCTTCCAGTTCGACCACGCCTACTACGCCAACCTGCAGGCCAGGCTGGGCCTGCTGGCCTCCGACCAGGCGCTGTTCCTGGAC
GCGCGCACCAGGCCGCTCGTGCAGGACCTCGCCGCCAACAAGACCCGCTTCTTCCAGGCGTTCGTGGCCAGCATGGACCGGATGGGCTCCATCCGGATCAAGAAGGGGAGGAAAGGAGAG
GTCAGGAAAGTCTGTAGCCAGCACCTGTTTTCAGCCTGA

Retrieve as FASTA