Entry information : ZmAPx04 (APx4 / GRMZM2G460406[6a])
Entry ID 6706
Creation 2009-04-12 (Christophe Dunand)
Last sequence changes 2011-02-18 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmAPx04 (APx4 / GRMZM2G460406[6a])
Name (synonym) ZmAPx04 (APx4 / GRMZM2G460406[6a])
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Endosperm
Glumes
Meristems
Pollens
Roots
Silks
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmAPx04
start..stop
S start..stop
SbAPx04 556 0 1..289 1..289
ScAPx04 513 0 1..289 1..291
TaAPx06 511 0 1..289 1..291
OsAPx04 511 0 1..289 1..291
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 216687296..216687408 113 N° 2 216676035..216676159 125 N° 3 216675405..216675454 50 N° 4 216675194..216675259 66
N° 5 216675068..216675116 49 N° 6 216674510..216674592 83 N° 7 216674361..216674440 80 N° 8 216674179..216674281 103
N° 9 216673869..216674069 201  
complement(join(216673869..216674069,216674179..216674281,216674361..216674440,2 16674510..216674592,216675068..216675116,216675194..216675259,216675405..2166754 54,216676035..216676159,216687296..216687408))


exon

Literature and cross-references ZmAPx04 (APx4 / GRMZM2G460406[6a])
Literature Lai,J., Dey,N., Kim,C.S., Bharti,A.K., Rudd,S., Mayer,K.F., Larkins,B.A., Becraft,P. and Messing,J. Characterization of the maize endosperm transcriptome and its comparison to the rice genome. Genome Res. 14 (10A), 1932-1937 (2004).
Protein ref. UniProtKB:   B4FA06   B4FRX8
mRNA ref. GenBank:   BT016732
Cluster/Prediction ref. UniGene:   Zm.6166
Protein sequence: ZmAPx04 (APx4 / GRMZM2G460406[6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 289
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
31542.31 Transmb domain: %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
o260-282i
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
7.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPMVDAEYLRQVDRARRHLRALISNKGCAPIMLRLAWHDAGTYDLKTKTGGANGSIRYEEEYTHGSNAGLKIAIDLEPIKAKNPKITYADLYLAGVVAVEVTGGPTVEFIPGRRDSSVCPREGRLPDAKKGAPHLRDIFYRMGLSDKDIVALSGGHTGRAHPERSGFDGAWTKEPLKFDNSYFLELLNEESEGLLKLPTDKALLSDPEFRRYVELYADEDAFFKDYAESHKKLSELGFTPRSTAPSKSDLPTAAVLAQSAFGVAVAAAVVIAGYLYEASKKAK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 8 introns) and 139 ESTs. First intron is very large and confirmed with ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCCATGGTCGACGCCGAATACCTGCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCGATCATGCTCCGCCTCGCGTACGTG
CGCCAATCGCTCACCTCCTCGCGCGCTAGTATACTCCCTCGAACCCCCTACTACTGTCGATTTTTTTCGCGGCCCTGTTGCCTCTGATTGGCATGGGGATTCCTGGGCTGTTGGACTCTT
GCCGGCTTAGTGGCCTGCTTGCTGCTCTCTCGTGCTTCACGGTTGAGATCACTGGTCTGTTTCCGTGCCTGGTAGTGGTTTCGTCTGATTTTGGTTTGGCTTTTTGGCGAAGCAATTTGT
CGAGCGTCTTGCCTGCGTGCGCGTGCTCTATCGTTAAGCGCATCCTAATCTTAGTTTCCTTACCGCGGTTGTCGCATTGACAAGTGAAGAGTAGGGGGTGATGAGTTTCGAGTTGTTAAA
TTCACGCATCTGATCCCGTTGATTGATGTTGTTAGAATCGTTAAGGTAGAACCCTCATTAAAATCAAAACCATATGTCAGTGCTGACGAAGCCGGTGGATCGGAGGAGCGGGTCTAAGTG
CCCGTGAAGGAATAGTGTCTCAGGGTGTGAGTGTTGAATTCGGTGTCGCGTTCGGCTGTAATAAGCAGGTTGTAATAGGCCGTGTGGGCCGTGCAAGTGTTGGAGTATAAAACATGCTGT
AAGACTTGGAAGAGGGGTATCCCAGAAATAATACAAACTGAAACGAACCAACCTTCTGGTTGTTCTGTGTCCGGCGATCACCTGAGTTGTTCACGAGCTCACGCGGGTGACGCCGCGTCG
ATCAGGGGCTGTGACAAGTGGTATTAGAGCCAAGCGGTCCTCGACGCAGATGCAGTTTCTGCTGTCGACCATGGTGACATCGTAACAGCGAAACGAGGAAAGGTGGGAGAAGATGGCGAA
GGTGCTGGATCGACTAGGAGATCGACTCAAGGTAATGGAGGCGAGTCACCAACGACTGCAGGAGCCGGCATATTTCGTCGCCATGGCGGCAAGGAGAGAGGAGGAACGGAAGAAGGCCGA
GGAGGAGAGATCAGTGCTGACTCGTCAGGTTGATGAAACTGGTAAGACCGTGGCACGTTTACGTTTGGAATTGCTTGCAAAGGATTTGGAGGTGGGTGATTCAGGATCTGATGGAGCTGG
TGGAGGTTCTCGGGGTTATGGTCGTGGAGGAAGGGAATGGGATCATGAGTCGGGAGGGCAGTACCATGATCAGTCAGGTGAAGGGGGAAGGAGGATGGAGCGTGATTAGTTTGGGAATGA
AAGTGTCAAGGGCGTCAAACCCCTGACTGGTCGGACCACGGCTATGTAGTTCGTAGCCGCCGTCCATCTTCTCCGGTGAGGATAAGCACCTCAACCGTAGGCTTGAGAGAATAGGAGTGT
AGGAGATAGTTTATTGCTTGCCTCCTCCCTGTGGTTTACAAGGATATATATATAGCCCTCAGCCCACTAATTTAGGAGCTGATAATAGGAAAGACCCACTACTTTGGTAACTAATAAAAA
GGAAGGAACAACCCTGTGGCGGAACCGCCCAGATCATTCCAGCTTAAGTGCCCAAGTCGCACCCTTAAAGGCACCAACACACTTAAACCGGAATAACCCGTCAGTCCCTCGGATCTAGTC
CGATAAAGCCACTTATCCAGGATCGAATACCACTAGCTCACACGAAGGTGAGGCACAGAGAAATACAATAAAGCATAATACCACAATTTTAAGAAGTATCATTAGTGATTACATTATCGG
AGTTTTAGAAATAATAACCATAAATTTTAATGCAGCGGAAATAACTAACGGAGAAAACCGAGTAACATGGCGAAGCCTGGCCACGCTACTCCTCCTGGTCCTCTCCTGCGGAAGCAGTAA
CCCACTCGACCATCTATCCCGGTGGCAGGGATGGAGGCCAAGTCACACCATCACCCAAAACAAGGAGGTACCTGCAAAAATTATGCCACAAGCAAAGTTGATACTCTGCTAGACTTACCC
GGTGTGAGGAGTCTACTCCTCTACCTCTAGACCATGAAGCTGTTTGGCTGAGGGGTTTGGTTTGCCAAAAGCACTAGCTGAGTCTGAAATCAAGTTTTAGATTTTCAAGTTCTAGAATAA
TAATTTTTGACTAGATGAGCACCTAACTATCCATTCATGGTAGCAAGCAATTTAGTCAACCAACATCTTTTGTAAGTAACCTCATTTCCACTTATTACTCAATGCAGTACAATGGATCAA
GCAGTCTCATTAGCTGCGAGAAGCAGACGATTCGAATCGAGTTTTAACCTTGCAAGGTAAACCTAAACACACGACATGTAGGGGCACTCCGTCCCCACACACATCAACCGTTCCCATCGA
TCCCCCGTTCGTGGCCAGGACTCACCGCCTTGGCATACAATGCTCCACTGACCTCGACCGCCGCCGTGCAGTGGCCGCACTTGTACCCACCATATCTGGAATGGGAGACCCAGTCTCAGG
ACAAGTGAGGGGTAAAGTCCGCGCCCGGCTTCACTCAGGTACTAGGCTTACCGGTTACCATATTTCCCGACATGTGTTTAGTATGTTCAAACGCTTGACACAGGTATCCGCACGTTAATC
CTTATTCCAATTTTGTCTCGTAGACAACGCATCCCCATGGATCCGTGTCCACAGACCATCATCATTCTGTTATCAAAATGGATACAACCAATTCCTGACCTCGCGCGAGTGCTAGAAAAA
TCACTCGACTTCTACCGAGATCCTGATTTAGCATAGCAGCTACTCGACCTATCATACTAGTATCCATCTCAAAAGGAATCCTGAGTTCATGCAACTAGGGTTTCAGGCAACTCCTACACT
TAAGTGCACGGTACAAGCCTACAAACATTAAGTGTAGTAAAATAGCATATATAAATGGTTATGCATAAAACTGAGGCTTGCCTGGAATTCAACACTAGATAGTGTTTGCTCGGGGATACT
CGCTTGGTGAGCATCTCCTATCCTGGCCTTTGTTCTGTCTGTCCATATTCAAGGCGTCTGCCAACACCGTCTTGGAGTCAGCTCCACTCCACGTCCTTTATCTCGCACGATCATCATCTC
TCGGTCCTAAATAAGATGCAAGATGCGTATGTATAAATATAATGAAAGTAGCACAAGATATACAAAGACACAGTGGCGAACTAAACATTAAATTGGAAGACACTGTAGACAACCACCTCT
CTATATAAGTCAAAACAATTTCTACTATCAACTAAGAGTTCTGGTATTAAACACATTATTACTTTCCGCGCACAAATAAACCTCAACTTAACACTCCGATGGATTTTTTTACTAAACTCA
TCATGCGCATAACCCCGTTTCGCATACAACCATATTGTGGCGTGCACTCGAGACACTTCGATCATCGTAGCGTAACCACTAATATATGAACTCCGGCACTCATGTCTTAACAATACATCC
TCCACACAACTAGCATTTTCTAAACTATTCGTCACATCAATAAATATATCCCCGATATAATCACGAATCCCATCACATTGCATAAAACAGATACACTTTTCACATAAACACGTATCGATA
CATTCCCCAAAACATGATCCGCATTTATTTATTTATTTATTTATTTAAACTTAGTCTTCGCATCAAACAACGCATCGCACATTTTTCCTATCAAAATATAAAAACATCCGAGTTTCTTTC
TACTTCGTCTTCTTCTCTACACGCTTTCATTCATACAATTATACTTTCACGCACATATTCACGCCATCGACTGAATCGTAAATAAAACGAAATCACAATTTTTCTAAAGCGAATAACCTG
GCCGACTCGTGTCGCGCATGCATGTATGTCGGTTTGGCTTTCTGTCGAGAAACGACGCGTGAAGCGCGACGACGACAAGGGGCTGCGATTAAACGACATACACAATTATTACACAATTTA
TTTGTTCAGTCATTTTATAAAATCAAGGAACACGGGACAGAGAGGAGCTCGCCGTGGGTTTCGACGACGACGCGCAGACGCTGCGCAGATCGACGACGTGAGGCCCGTTTTGGCGAGCGC
GGCGCAGCGAAGGGCGTTGCTGCTGCTGCTGCAATACGTCGAGCACGACGAGGGCGCGACGCGGAGGGAATCCATGTGGCTGCGCGAACTGGCATCGCGGCTGCTGCGCGAGGTCAACGG
CGTCGCACAAGCGTTGCGCAGATCAACATGGGTTGGGAAGGTGCAGGTCGAGTTCGAGTCCGCTGCGACATCCCGTCGAGCAAGAGATGGAGGTGTGCTTCATAGTGCCGAACAGAGGAG
ATTCTGCGCAGGAGCGTTGGATGGAGAATGCCGATGGAGCTCAAGCATCGAGGATGGCTGTTCGCGTGGCTCTGATGCGCGCGGCCATGGAGCCGGGACATGCACGGCGTCGGACGGGGA
GAAGCCGTAGGGGAGACAGCGGTCATCGGCCGACACTTGTGCGCGTCCAGGGGAAACAGAGAGGGCGAGCAACAGCAGGGGAGAGAGCTTGGCGGCCATGGAAAATGGCGCTCGCGCATT
GCTGGAGAGTGCCCACCCGAGTCCGGACCAGAGGAGGTCGAGTAGATGGCGAGGGGAGGATGCAGGGGCCTGCCTGCCGCCGAGCGCCGAGGTGCCGGGAAGGGGCGCATCCATGGAAGA
GGGCACGCCAGCACGCCTGCTCGAGCTCGGACGCAGGAATGGAGCCCCGAGGGGGAGGGGTGGCGCCATGGAGGGAGGTCGGAGCCGATGCCCCGACGACGTTGACGCCCGTGAAGGCAG
GAGCAGGGGCACGCGCCGGATCTGAGCACCATGGAACAGAGAAGGCACCACACGCTGAGGAGAGAGGGAGCGGAGAGGGGGATTCCATGGCAAGAGGAGCGGTCACCAGGGCTCCATGGA
CGAGCAGGAGCAGAGGGAGGAAGGTGGCCGGAGGTGGAAGACGAGCAGGCTACGTGCGTGAGAAGCCTGGCGGCCAGGAAAATGGAAGAAGGAAGTGGCTGGCTGATTGATTTAACGGGG
CACTGCTAGCAACCCATTGGCCACCGTGGGCGACAGCCATCTACTGGCCGGCTGCAGCTATTGGCGCAGAGAACGGCGACCAGCTACTGGCCAGGGACTGGCAGTGGCAGCCGTTGGCCG
GGTATTGGCTGCAAGCCTGAGCAGACCGTGGCGTGCGGGAGAAAAGAAAACAGATGCTGGTGAATTATTTAGAGAGAAAAAGGGCTGATTGTTTAGGAGCTAAATATTTTTTTATTTGAT
TTCTCTGAGACAAGAGCTCCCGTATGAGTTGTTTATCAAGACGGTGACAATTATTGGTTGGAGAGGAGTGGTCATCTGTCGGCCGATTTGCGCAGCGCTTATTCGTTGGCTGAGACCCAC
GCAGGGAACAGAGCGAACTGACGTACGGATGAACGAGAGGCCACAGAATAAAATAGACCGAGACATTTTATTTGGGTGTTGCTTGGAAATTAAATTCTCGCGCATAAGTAGGAATAAAAT
GAATCGAGATCGATCGGCTTCAGATTCGGCATCGAAATAAAACGGGTCGGATTAATAAAAATCATTGCCGAGGTTGGCTTTTGAATTTAGATGGGACACAGAGATTTTAAGCCGAGTAGG
ATAAAAGTAAATAGGTGCCAACACGTGGAGTATTCCGTTTGAGAGCACGGACTCGGATTAATTTTTGGACATAGATCGAACATCGAGAAATTGGATTCGGACACAGCTCGACTAGCAACT
GTCGAGCGCCTGATTAAATGAGCTTCAGACGAGATTTACAAATCGAGATTGATTATCGAGTTTGTATTCGTGTCGAGAAATAAAAGTTTTAATAGGCTCCAAAGTTGGCCTTCTGTGAGA
GTGAATAACTCCGAATTCGATGAAAGGTGAATGAATAGTCCGGATAATCAGAGACATACGCGAGTGAGAAATAAATTTTTTACTGAGCATCCGAGATTAGGATAAATCTCTCGATATAAC
ACGAAATAGACACCTGGGGTGTCACAAACCCCCCAATAGGAGCTAATAATAGGAAGAGCCCACTAATTTAGGAGCTGATATTATGATCACATTCTCATATATAGTCCAACCTTGAAAGAG
CATTATGATCACTTGAGGCTGGTCTTTGCTAAGCTTAGAGAACACAAGTTCTACCTGAAACACAAGAAGTGTTCCTTTGTGCAGCAGGAACTTCAGTATCTGGGGCATATCATTTCCAGA
AAAGGGGTAGCCGCTGACCCAGCCAAGGCAGCTGCTATGCTAGCCTGGCCACAGCCTCAGAATGTCACTGAGTTAAGAGTTTTCCTTGGGCTCACAGGCTAATACAGAAAATTTGTGAGG
AATTATGGGTTGCTAGCTAAACCCTTGACTGTTCTTCTGCAGAAACAAACATAGTTTTCAGTGGACAACTGCAGCACAATAGGCTTTTCATTCCCTGAAACAAGCTATGACCACTGTAGA
AGAGTGAACTCGATGTATTGCATAGAGGTGGACTACAATATATAGAGACACAGGAAACCCTAACCCTAATGGACCGGCAGCCCAACAGTGGTGCCGGCCCACACACACATAGTCTAACAT
CCCCCCGCAGTCGCAACGGGGGCACCACACACGATGAGACTGGAGTAGAGGCTGAAGGTAGGAGCCGACGGGTTGACCCCCCCCCCCCCCCCGCAGTCGCAGCGTCGTGATGGTGCGAAT
GTTGCGGCTGGAGTAGAGACCGTTGTGTGCTCCAAGAAGACGATAGCCCCTAGATGCCGAGGTAGCCGAAGTCGAGGTGGTCGCGGTCGGAAGACGCACAGCAAAAGCCTGATCTTCGGG
AGGGGTCGACGTTCGAGCGTCAACGATCGGCAGGGCGACACAGCAAAAGGGCACCGGCAGGCCGACCTGCTTCTTCGATCGACCAGACGTCAAGGAGCCCCGCCAGGGAGGCCGACAGCA
GCGCACGCGGCTGCGCCGATCATGGTGTCCGCGCCCGCGGCAGAAAAGAACGGGAATGTCGGATCCGGTCGGGAAGGCCACGGCAGCGACGGATCCGGACGGGAAGATGCGATTCAGCCA
AAGGGACGGCGGATCGAGCCGAAAAGGTCGCAGCAACGTGGATCCGGCCGGGAAGGCCGCGGCAGCGACGGATCCAATGAAGGGAGTAGGCGGCGGGGTGGGTCCAGCCAGGCAGGGGCC
TGCGCCGGACCTGGCAAGGGGTGTTGACGGCATCGGTGACAGGAAAAGCTCAAAGTGGGAGGCGCTGCTTGGGCGTCAACACGGGCAATTAGGAGGTGGCTAGCGCGATGACAAGGGGCT
GCAAAGCGCAGGAGCGGCCTGCTGGCCGGGCGGCGGCGGAAGAGAGGGTGCCGCTGCTAGGGGCGCCTGCTGTGGCGGCGGCGAGGCCACCCACGCCAGGAACAGAGACCGGCGAGGTCG
CCCGCGCCTACTGCAGCGGCAGCAAGGCCGAGGAGCTAGCCCGGCGACGAATCTGGGCAAACGTCTGGGTGTAGGGGGAGAGGCGATCGGAGATGGCGGCTGGTCTTAGGGCGAGCCCGA
GCGGGGCCTTGGCGGCCTGAGCGCCTGCACCGGGGAAGAAGGCCGCATGGAGGGGCTGCCGAGCAGTGGGAGATGAGGAGGAAGGGAGAGGTGAAGGCGCCGCGCCCCGGAGGGTGGACC
AGTCACGCGTCCTGGGCGTAGACCAGTCACGCGCTCGTGGAACTCGGCGACCGTCTTCTCGGCCGCCGCGGGCAGCGCCCCAGCGCGGCAGCGCGCCTGGGCGACGAAGACGAGGAACTC
CTCCTGGCACAACACGAAGGCCTCGAGCAGGCGGCGGATCTACGCGGCGGAGAGGAACTCCTCGCCTGCCCCGGCGGCGGCGTCGCTATGGCGGACCCGGTCCGAGCCCCGGCGGCCACG
GCGCGGCATGGTCTGGCCCTCGACGGCCTCGGCGCGGGCGCTCGCAGCCCCGCCAGGTCGTGAGGCGACGCGGCCGGGCAGGGAAGGTCGCGTGCACGCGCGGTCGTCCTGCGGCGGCGC
GGGCGCGCGGCCAGGCAGGAACTCCCCGCAGAGGGAGAGGCTGGAGACGCGGGCTGACGGAGCCCGCGTGGACCCGCAGCACCACCAGCGCCTTGCACGGCCCCGCCGGCGGGAAGGCGG
ACGGGGTGGGGGAAAGAGGGAGGCCTCGGCGGCCGAGGGAGAGTGCCGGCGGCTGGGGGCCAAAGGCTGGCAGCCGGCTGGGGAAGGGGTGGGGGTGCGGCTGCCTGCCCAGGGAGACAG
CGGCGGCGGCTGGGAGGAAGGAGGCCACCCCCGGGAGGGAAGGTTGGGCCTCCCGGGGGCAGCGATGGCAGGCGGCGGCTGGGTGGGAGGGAGCCGCCGGCGGCTGCGGTGGGAGAGAGA
GGAAGAAACCCTAAAACTAATTCTCTGATACCATGTAGAAGAGTGAACTCGATGTATTGCATAGAGGTGGACTACAATATATAGAGACACAGGAAACCCTAACCCTAATGGACCGGCAGC
CCAACAGTGGTGCCGGCCCACACACACTCACACACACATAGTCTAACAACCACCACACCTGTGCTAGCCTTACCCAGATTTGATTTGCTTTTTGTGATAGAAACTGATGCATGTGATGAT
GGCTTAGGAGCAGTCCTTATGCAGAAAGGGAGACCAATTGCTTTCATTAGCAAGGCTTTGGGCCAGAATAATAAGCACTTATCTATCTTTGAGAAGGAGTTCCTTGCATTAATCTTAGCT
GTAGATCGGTGCATAAGTCCCTTACCTTCCTAGGGGAGCAACACCTCCAATCAGACTTACAAACGAAAGCCATGACCAAACTGATGGACCTTCAATTTTAGATTGTTTACAAGAAAGGGT
CTGAAAACGTGGTTGCTGATGCACTTTCCAGGGTGGGTTCAGCCATGGAGTTGTCTGCTTTGTCTGAAGTGCAACCGGTTTGGATACAAGAAGTAGTCAATTCCTATATCACTGATGCTG
AAGCTCAGGAACTGCTGACCAAACTGCTAATCCAGAGCCCAGATGAGCAAGGCTTCTGTCTTCAACAAGGCATTATTAGGAGGGGCAGGCAAGTGTGGATTGGTGCAAACTCAGCTCTCA
GAACTAAGCTGATTTCAGCTTTGCATGCCAGTGCTAATTGGTGGACATTCTGGTGGGCCAACTACCTACCAGAGGGTGGGGAGACCTTTTATTGCAAAAGGCTCCAATCTGATGTTATGC
TATTTGTGCACCAGTGTCAACCCGTCAGCAAGCCAAGTCTGACAGGGTGCACCCAGCAGGCTTACTTCAACCATTACCTGTCCCTAGGGGAGCTTGGGAAGAAATTACAATGGATTTTAT
TGAGGGCTTGCCTAAATCTGAAGGTTTTGATATTATTCTGGTTGTGGTGGACAGGTTTACCAAGTTTGCACATTTTCTACCCTTAAAACATCCTTTCACTGCTCAAAAAGTGGCTCAAGT
TTTCTTGGATCAGATAGTGGAACCCCATGTGGCTCCAAAATCTATTGTTTCTGACAGAGATAAATTGTTTACTAGTCAGTTTTGGAGACATCTGTTTCAGTTGATGGATGTGCAACTTCT
GTTCTCTACTGCCTACCATCCACAAACAGATGGTCAGAGTGAGCGTGTCAATCAGTGTTTGGAGATGTCTTTAAGATGTGCAGTGAATGACCACCCTCAGAAATGGAAGGGCTGGTTAGC
TCTTGCAGTGTACTGGTATAATACCAGCTACCACTCTTCTTTGGGATGTACTCCATTCATAGTGATGTATGGCTATGATGCACCTGCTGTTGCTATACCTTGTTTGGCTCACTCTGATGA
TGTCGAGGTAAATCAGTGGCTTACTGACAGAGCTGCTTACTCAGCTATGCTCAAAGAACATTTGACTCGGGCTCAACATAGGATGAAACAGTTTGCCGACAAGGGCAGAACTCCAAGAGA
GTTTAGCATTGGGAACTTAGTGCTTCTAAAGTTGCAGTCGTATGCTCAGAAGACTGGTCAATCGACCCTGCCCAAAACTTGCCTTCAAGTTTTTTGGTCCTTTTCGGGTTCTGAACAAGG
TAGGGTCTATGGCTTATCGTTTCAGGTTCCTCAAGATGCTCAGGTTCATCCGGTGTTTCATGTGTCGCAACTTAAGCTGTTTCATCCAAGGTACACACCTGTGTTTGCTACTCTACCTCG
TGTGGCTGATTTATCTGTTGCTAGTGTGGAACCTGAAGATATTTCGGATCATCGCCTCGTCCACAAGAGGAATCAGGCTATCACTCTGTGATATCAAGTGGTCTCACCTTCCAGTGCAGA
CTGCTACATGGGAGGATGCTAATGTGGTCAAGGAGTGTTTTCCTGATGCAATCGCTTGGGGACAAGCGATATCCGCGCCCTGGGGACATGTCAGTGCCGACGAAGCCGGTGGATCAGAGG
AGCGGGTCTAAGTGCCCGAGAAGGAATAGTGTCTCAGGGTGTGAGTGTTTTGAATTTGGTCGTGTTGGGCTGTAATGAGCAGGTTGTAATGGGCCGTGTGGGCCGTGCAAGTGTTGGAGT
ATGAAACATGCTGTAAGACTTGGAAGAGGGGTATCCCAGAAATAATACAAACTGAAACGAACCAACCTTCCGGTTGTTCCGTATCCGGCGATCACCTGAGTTGTTCCCGAGCTCACGCCG
GCAACGCCGCGTCGGCCAGGGGCTGTGACACGATAGCACAATCTGTGTTATACAGTAACGTTGCCACTATCACAAACGTTTTTTTTTTTCAATTCCATAGAGAGATCGTGGAAAGCTGAC
ACAAGATACATGTTCTAGCTCAACTGGGATTTCCTCTGCTTTATTCATGTCATTATGTGGACTGTGGAATTGCTGAGAGGTGGGTAGGGTACCTCTGTATTCCTGTATGAGTTAGGACTT
AGGAGAAAGTATTTTATCCACTAATAGAAGGAAGTATATGGTGCTCACTTAGTAACAGCTTATGAGAAGCTCCAGTAGAGCACAATTTTGTAGAGGGCCAGTCAAACTGATATGGTGACT
AGTTTATATGTTGGAGTTCCCATTTTATATTTTTAGGTACATTGGGTTCCTCTATATGCCGTTGATCTGTAACCAGTTAAAAATCACACCAGTTTGACCTCCATTTGCTCTAGGATTCAG
CCAGGAATGTATTCTGCTTAATATGGATTGAGCTTACACCATTCTTCCCTTCATTCAATCATTGAAGACTTCTTTGCTCTCCCTTGCAGATGGCATGATGCTGGAACTTATGACCTGAAG
ACAAAAACTGGTGGTGCAAATGGTTCGATTAGATATGAAGAAGAGTACACTCATGGTTCAAATGCTGGTTTAAAGATTGCTATCGATCTCCTTG
GTATGCATCGGTTATACTCAATTATA
TTCTAGATGCCTATGAAAGAATATATTAACATATAAGTTAAGTACGGACTACTTGAATGAGGATTTCGAAGAAATCAATTTACACCGTTTTCTAGTTACTTCTCATAAACTGAAACTCCT
TTCCTGTGGCTGTGGGTTTTCTGCTATCTTCAAGGTCAGACAACAATATATTGGTTTTCGTGTCAATTGTTCTGGGATGATAAATTAAGAAAACTATGTAATGCTTTTAGCCGCTTAGGG
AAGAAGTCCTCTCATAAATATCTACTTGGTCAGAACTATTAGGTTCTAGGTCTATGCCCTGTCATGCAGACATGCAGTTAGACTATTATACGCACGACAATGGTTACCTGTATACCATTA
AGCCTTAAATGTAATATCGGGAGGTGTCTCAGTCAGAGCAATTGCAGTTTATGTGAATCCTACTACATTTGTATATCGTACTTCATGTGGAATGATGGTGATTTGTGTTTCTTGTTTTCT
TCTGTATTTCTTCACTGCTAAAATAAATGAAATCATTACTATTGCTTATTCAATTGTCTTTTGTTTTCCTCTAGAGCCTATCAAAGCAAAGAATCCAAAGATAACATATGCAGACCTGTA
TCAG
GTAATTTGGTATCACCTTCATTTTGCTCTTCTATAGGATGTTTGGCCTTCTCTAACCCTGTCGTGATTGGGCTTTTTTATCCTGTTGGGAACTGTGAAACTCTGGATTCAGTATAA
ATACTAACCTACATGGAATTTATAAACAGCTTGCTGGAGTGGTTGCAGTCGAAGTGACTGGGGGGCCAACTGTTGAATTTATTCCTGGCAGACGTGTATGTAAAAAAAACATTTCTTCGT
GATTGGATTCATCTTCCTGATGTTCACTCTTTAACTGGTTGACACTAATCAGGATTCGTCGGTGTGCCCCCGTGAAGGGCGTCTGCCAGATGCTAAGAAAGGTATTTACTACCTTGGGCT
ATACTTGTGTGATTGAATTGTAACATGTATCCTAACATTATTATTTTAACGTGGTTTTCTGGAAGTTTGAGAGGGAGGGAAGGAAGAATGGTACTTGTGTAATTCATGTGTAAAACTATC
TTGTTCCTGTCAGCATCGAACAGTTATGCATATCTGGGCTCCATGTTTGCCTGAAGTTTTATTAAACAACATAAGGGCTAGTTTGGGAACCTTATTTTCCCATGGGAAAATGAACTAATT
TCCCTTGGGAAAATGGGGTTCCCAAACTAGCCCTAAAAATTATTTTCTATTAGGAGCTGTTCCTGGTCCTGCCTTTATTTAACTAGTACTATATATAACATGTGTTTGTATCCAGCTTTG
GTATACTGATGGTTTGATGTCATTGTGTACTTATTATTTGATCATGTCTGTTGCTAATGTACATCTCTTGTTTTTTTGGATTCATTTCGTGAATAGGTGCACCACATCTGAGGGACATCT
TTTATCGGATGGGCTTATCGGACAAAGATATTGTAGCTCTATCAGGGGGACATACTCTG
GTAAATGGTTTGTCTCTGAAGGAGTACTCATTTGTTCATACGCACATCTTGAGACATTTGT
TCTTTTAGGGAAGGGCTCACCCTGAGAGGTCTGGATTCGATGGTGCCTGGACAAAGGAGCCTCTTAAGTTTGATAACTCATACTTTCTGTAAGTTGAACAAAGTCAGAATTTCTACTTGG
TTTACTGACTAGATTCCATATTAAACGAGGGTGCATTGTTACTGCAGTGAGCTGTTGAATGAGGAATCTGAGGGACTTTTAAAGCTCCCAACTGACAAGGCACTGTTATCAGATCCTGAA
TTTAGGCGCTATGTGGAGCTCTATGCAAAG
GTGAATAAGACTTATAGATATCCTTGTGCACAGCACACTTTAGCACCTTGTTTGATTATACAAGCTTCAGATCCACTGATTCAGAACCAT
GTCTTTGTTCGTACCGTAGGATGAAGATGCGTTCTTCAAAGATTATGCTGAATCACACAAGAAACTCTCTGAGCTTGGCTTCACGCCTCGCAGCACAGCACCATCCAAATCAGATCTTCC
AACCGCCGCCGTGCTTGCACAGAGTGCCTTTGGGGTAGCAGTTGCTGCAGCCGTAGTTATCGCTGGCTACTTGTACGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCCATGGTCGACGCCGAATACCTGCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCGATCATGCTCCGCCTCGCATGGCAT
GATGCTGGAACTTATGACCTGAAGACAAAAACTGGTGGTGCAAATGGTTCGATTAGATATGAAGAAGAGTACACTCATGGTTCAAATGCTGGTTTAAAGATTGCTATCGATCTCCTTG
AG
CCTATCAAAGCAAAGAATCCAAAGATAACATATGCAGACCTGTATCAG
CTTGCTGGAGTGGTTGCAGTCGAAGTGACTGGGGGGCCAACTGTTGAATTTATTCCTGGCAGACGTGATTCG
TCGGTGTGCCCCCGTGAAGGGCGTCTGCCAGATGCTAAGAAAG
GTGCACCACATCTGAGGGACATCTTTTATCGGATGGGCTTATCGGACAAAGATATTGTAGCTCTATCAGGGGGACAT
ACTCTG
GGAAGGGCTCACCCTGAGAGGTCTGGATTCGATGGTGCCTGGACAAAGGAGCCTCTTAAGTTTGATAACTCATACTTTCTTGAGCTGTTGAATGAGGAATCTGAGGGACTTTTA
AAGCTCCCAACTGACAAGGCACTGTTATCAGATCCTGAATTTAGGCGCTATGTGGAGCTCTATGCAAAG
GATGAAGATGCGTTCTTCAAAGATTATGCTGAATCACACAAGAAACTCTCT
GAGCTTGGCTTCACGCCTCGCAGCACAGCACCATCCAAATCAGATCTTCCAACCGCCGCCGTGCTTGCACAGAGTGCCTTTGGGGTAGCAGTTGCTGCAGCCGTAGTTATCGCTGGCTAC
TTGTACGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA