Entry information : ZmAPx04 (APx4 / GRMZM2G460406[6a])
Entry ID 6706
Creation 2009-04-12 (Christophe Dunand)
Last sequence changes 2011-02-18 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmAPx04 (APx4 / GRMZM2G460406[6a])
Name (synonym) ZmAPx04 (APx4 / GRMZM2G460406[6a])
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Endosperm
Glumes
Meristems
Pollens
Roots
Silks
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmAPx04
start..stop
S start..stop
SbAPx04 556 0 1..289 1..289
ScAPx04 513 0 1..289 1..291
TaAPx06 511 0 1..289 1..291
OsAPx04 511 0 1..289 1..291
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 216687296..216687408 113 N° 2 216676035..216676159 125 N° 3 216675405..216675454 50 N° 4 216675194..216675259 66
N° 5 216675068..216675116 49 N° 6 216674510..216674592 83 N° 7 216674361..216674440 80 N° 8 216674179..216674281 103
N° 9 216673869..216674069 201  
complement(join(216673869..216674069,216674179..216674281,216674361..216674440,2 16674510..216674592,216675068..216675116,216675194..216675259,216675405..2166754 54,216676035..216676159,216687296..216687408))


exon

Literature and cross-references ZmAPx04 (APx4 / GRMZM2G460406[6a])
Literature Lai,J., Dey,N., Kim,C.S., Bharti,A.K., Rudd,S., Mayer,K.F., Larkins,B.A., Becraft,P. and Messing,J. Characterization of the maize endosperm transcriptome and its comparison to the rice genome. Genome Res. 14 (10A), 1932-1937 (2004).
Protein ref. UniProtKB:   B4FA06   B4FRX8
mRNA ref. GenBank:   BT016732
Cluster/Prediction ref. UniGene:   Zm.6166
Protein sequence: ZmAPx04 (APx4 / GRMZM2G460406[6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   289
PWM (Da):   %s   31542.31 Transmb domain:   %s   o260-282i
PI (pH):   %s   7.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPMVDAEYLRQVDRARRHLRALISNKGCAPIMLRLAWHDAGTYDLKTKTGGANGSIRYEEEYTHGSNAGLKIAIDLEPIKAKNPKITYADLYLAGVVAVEVTGGPTVEFIPGRRDSSVCPREGRLPDAKKGAPHLRDIFYRMGLSDKDIVALSGGHTGRAHPERSGFDGAWTKEPLKFDNSYFLELLNEESEGLLKLPTDKALLSDPEFRRYVELYADEDAFFKDYAESHKKLSELGFTPRSTAPSKSDLPTAAVLAQSAFGVAVAAAVVIAGYLYEASKKAK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 8 introns) and 139 ESTs. First intron is very large and confirmed with ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCCATGGTCGACGCCGAATACCTGCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCGATCATGCTCCGCCTCGCGTACGTG
CGCCAATCGCTCACCTCCTCGCGCGCTAGTATACTCCCTCGAACCCCCTACTACTGTCGATTTTTTTCGCGGCCCTGTTGCCTCTGATTGGCATGGGGATTCCTGGGCTGTTGGACTCTT
GCCGGCTTAGTGGCCTGCTTGCTGCTCTCTCGTGCTTCACGGTTGAGATCACTGGTCTGTTTCCGTGCCTGGTAGTGGTTTCGTCTGATTTTGGTTTGGCTTTTTGGCGAAGCAATTTGT
CGAGCGTCTTGCCTGCGTGCGCGTGCTCTATCGTTAAGCGCATCCTAATCTTAGTTTCCTTACCGCGGTTGTCGCATTGACAAGTGAAGAGTAGGGGGTGATGAGTTTCGAGTTGTTAAA
TTCACGCATCTGATCCCGTTGATTGATGTTGTTAGAATCGTTAAGGTAGAACCCTCATTAAAATCAAAACCATATGTCAGTGCTGACGAAGCCGGTGGATCGGAGGAGCGGGTCTAAGTG
CCCGTGAAGGAATAGTGTCTCAGGGTGTGAGTGTTGAATTCGGTGTCGCGTTCGGCTGTAATAAGCAGGTTGTAATAGGCCGTGTGGGCCGTGCAAGTGTTGGAGTATAAAACATGCTGT
AAGACTTGGAAGAGGGGTATCCCAGAAATAATACAAACTGAAACGAACCAACCTTCTGGTTGTTCTGTGTCCGGCGATCACCTGAGTTGTTCACGAGCTCACGCGGGTGACGCCGCGTCG
ATCAGGGGCTGTGACAAGTGGTATTAGAGCCAAGCGGTCCTCGACGCAGATGCAGTTTCTGCTGTCGACCATGGTGACATCGTAACAGCGAAACGAGGAAAGGTGGGAGAAGATGGCGAA
GGTGCTGGATCGACTAGGAGATCGACTCAAGGTAATGGAGGCGAGTCACCAACGACTGCAGGAGCCGGCATATTTCGTCGCCATGGCGGCAAGGAGAGAGGAGGAACGGAAGAAGGCCGA
GGAGGAGAGATCAGTGCTGACTCGTCAGGTTGATGAAACTGGTAAGACCGTGGCACGTTTACGTTTGGAATTGCTTGCAAAGGATTTGGAGGTGGGTGATTCAGGATCTGATGGAGCTGG
TGGAGGTTCTCGGGGTTATGGTCGTGGAGGAAGGGAATGGGATCATGAGTCGGGAGGGCAGTACCATGATCAGTCAGGTGAAGGGGGAAGGAGGATGGAGCGTGATTAGTTTGGGAATGA
AAGTGTCAAGGGCGTCAAACCCCTGACTGGTCGGACCACGGCTATGTAGTTCGTAGCCGCCGTCCATCTTCTCCGGTGAGGATAAGCACCTCAACCGTAGGCTTGAGAGAATAGGAGTGT
AGGAGATAGTTTATTGCTTGCCTCCTCCCTGTGGTTTACAAGGATATATATATAGCCCTCAGCCCACTAATTTAGGAGCTGATAATAGGAAAGACCCACTACTTTGGTAACTAATAAAAA
GGAAGGAACAACCCTGTGGCGGAACCGCCCAGATCATTCCAGCTTAAGTGCCCAAGTCGCACCCTTAAAGGCACCAACACACTTAAACCGGAATAACCCGTCAGTCCCTCGGATCTAGTC
CGATAAAGCCACTTATCCAGGATCGAATACCACTAGCTCACACGAAGGTGAGGCACAGAGAAATACAATAAAGCATAATACCACAATTTTAAGAAGTATCATTAGTGATTACATTATCGG
AGTTTTAGAAATAATAACCATAAATTTTAATGCAGCGGAAATAACTAACGGAGAAAACCGAGTAACATGGCGAAGCCTGGCCACGCTACTCCTCCTGGTCCTCTCCTGCGGAAGCAGTAA
CCCACTCGACCATCTATCCCGGTGGCAGGGATGGAGGCCAAGTCACACCATCACCCAAAACAAGGAGGTACCTGCAAAAATTATGCCACAAGCAAAGTTGATACTCTGCTAGACTTACCC
GGTGTGAGGAGTCTACTCCTCTACCTCTAGACCATGAAGCTGTTTGGCTGAGGGGTTTGGTTTGCCAAAAGCACTAGCTGAGTCTGAAATCAAGTTTTAGATTTTCAAGTTCTAGAATAA
TAATTTTTGACTAGATGAGCACCTAACTATCCATTCATGGTAGCAAGCAATTTAGTCAACCAACATCTTTTGTAAGTAACCTCATTTCCACTTATTACTCAATGCAGTACAATGGATCAA
GCAGTCTCATTAGCTGCGAGAAGCAGACGATTCGAATCGAGTTTTAACCTTGCAAGGTAAACCTAAACACACGACATGTAGGGGCACTCCGTCCCCACACACATCAACCGTTCCCATCGA
TCCCCCGTTCGTGGCCAGGACTCACCGCCTTGGCATACAATGCTCCACTGACCTCGACCGCCGCCGTGCAGTGGCCGCACTTGTACCCACCATATCTGGAATGGGAGACCCAGTCTCAGG
ACAAGTGAGGGGTAAAGTCCGCGCCCGGCTTCACTCAGGTACTAGGCTTACCGGTTACCATATTTCCCGACATGTGTTTAGTATGTTCAAACGCTTGACACAGGTATCCGCACGTTAATC
CTTATTCCAATTTTGTCTCGTAGACAACGCATCCCCATGGATCCGTGTCCACAGACCATCATCATTCTGTTATCAAAATGGATACAACCAATTCCTGACCTCGCGCGAGTGCTAGAAAAA
TCACTCGACTTCTACCGAGATCCTGATTTAGCATAGCAGCTACTCGACCTATCATACTAGTATCCATCTCAAAAGGAATCCTGAGTTCATGCAACTAGGGTTTCAGGCAACTCCTACACT
TAAGTGCACGGTACAAGCCTACAAACATTAAGTGTAGTAAAATAGCATATATAAATGGTTATGCATAAAACTGAGGCTTGCCTGGAATTCAACACTAGATAGTGTTTGCTCGGGGATACT
CGCTTGGTGAGCATCTCCTATCCTGGCCTTTGTTCTGTCTGTCCATATTCAAGGCGTCTGCCAACACCGTCTTGGAGTCAGCTCCACTCCACGTCCTTTATCTCGCACGATCATCATCTC
TCGGTCCTAAATAAGATGCAAGATGCGTATGTATAAATATAATGAAAGTAGCACAAGATATACAAAGACACAGTGGCGAACTAAACATTAAATTGGAAGACACTGTAGACAACCACCTCT
CTATATAAGTCAAAACAATTTCTACTATCAACTAAGAGTTCTGGTATTAAACACATTATTACTTTCCGCGCACAAATAAACCTCAACTTAACACTCCGATGGATTTTTTTACTAAACTCA
TCATGCGCATAACCCCGTTTCGCATACAACCATATTGTGGCGTGCACTCGAGACACTTCGATCATCGTAGCGTAACCACTAATATATGAACTCCGGCACTCATGTCTTAACAATACATCC
TCCACACAACTAGCATTTTCTAAACTATTCGTCACATCAATAAATATATCCCCGATATAATCACGAATCCCATCACATTGCATAAAACAGATACACTTTTCACATAAACACGTATCGATA
CATTCCCCAAAACATGATCCGCATTTATTTATTTATTTATTTATTTAAACTTAGTCTTCGCATCAAACAACGCATCGCACATTTTTCCTATCAAAATATAAAAACATCCGAGTTTCTTTC
TACTTCGTCTTCTTCTCTACACGCTTTCATTCATACAATTATACTTTCACGCACATATTCACGCCATCGACTGAATCGTAAATAAAACGAAATCACAATTTTTCTAAAGCGAATAACCTG
GCCGACTCGTGTCGCGCATGCATGTATGTCGGTTTGGCTTTCTGTCGAGAAACGACGCGTGAAGCGCGACGACGACAAGGGGCTGCGATTAAACGACATACACAATTATTACACAATTTA
TTTGTTCAGTCATTTTATAAAATCAAGGAACACGGGACAGAGAGGAGCTCGCCGTGGGTTTCGACGACGACGCGCAGACGCTGCGCAGATCGACGACGTGAGGCCCGTTTTGGCGAGCGC
GGCGCAGCGAAGGGCGTTGCTGCTGCTGCTGCAATACGTCGAGCACGACGAGGGCGCGACGCGGAGGGAATCCATGTGGCTGCGCGAACTGGCATCGCGGCTGCTGCGCGAGGTCAACGG
CGTCGCACAAGCGTTGCGCAGATCAACATGGGTTGGGAAGGTGCAGGTCGAGTTCGAGTCCGCTGCGACATCCCGTCGAGCAAGAGATGGAGGTGTGCTTCATAGTGCCGAACAGAGGAG
ATTCTGCGCAGGAGCGTTGGATGGAGAATGCCGATGGAGCTCAAGCATCGAGGATGGCTGTTCGCGTGGCTCTGATGCGCGCGGCCATGGAGCCGGGACATGCACGGCGTCGGACGGGGA
GAAGCCGTAGGGGAGACAGCGGTCATCGGCCGACACTTGTGCGCGTCCAGGGGAAACAGAGAGGGCGAGCAACAGCAGGGGAGAGAGCTTGGCGGCCATGGAAAATGGCGCTCGCGCATT
GCTGGAGAGTGCCCACCCGAGTCCGGACCAGAGGAGGTCGAGTAGATGGCGAGGGGAGGATGCAGGGGCCTGCCTGCCGCCGAGCGCCGAGGTGCCGGGAAGGGGCGCATCCATGGAAGA
GGGCACGCCAGCACGCCTGCTCGAGCTCGGACGCAGGAATGGAGCCCCGAGGGGGAGGGGTGGCGCCATGGAGGGAGGTCGGAGCCGATGCCCCGACGACGTTGACGCCCGTGAAGGCAG
GAGCAGGGGCACGCGCCGGATCTGAGCACCATGGAACAGAGAAGGCACCACACGCTGAGGAGAGAGGGAGCGGAGAGGGGGATTCCATGGCAAGAGGAGCGGTCACCAGGGCTCCATGGA
CGAGCAGGAGCAGAGGGAGGAAGGTGGCCGGAGGTGGAAGACGAGCAGGCTACGTGCGTGAGAAGCCTGGCGGCCAGGAAAATGGAAGAAGGAAGTGGCTGGCTGATTGATTTAACGGGG
CACTGCTAGCAACCCATTGGCCACCGTGGGCGACAGCCATCTACTGGCCGGCTGCAGCTATTGGCGCAGAGAACGGCGACCAGCTACTGGCCAGGGACTGGCAGTGGCAGCCGTTGGCCG
GGTATTGGCTGCAAGCCTGAGCAGACCGTGGCGTGCGGGAGAAAAGAAAACAGATGCTGGTGAATTATTTAGAGAGAAAAAGGGCTGATTGTTTAGGAGCTAAATATTTTTTTATTTGAT
TTCTCTGAGACAAGAGCTCCCGTATGAGTTGTTTATCAAGACGGTGACAATTATTGGTTGGAGAGGAGTGGTCATCTGTCGGCCGATTTGCGCAGCGCTTATTCGTTGGCTGAGACCCAC
GCAGGGAACAGAGCGAACTGACGTACGGATGAACGAGAGGCCACAGAATAAAATAGACCGAGACATTTTATTTGGGTGTTGCTTGGAAATTAAATTCTCGCGCATAAGTAGGAATAAAAT
GAATCGAGATCGATCGGCTTCAGATTCGGCATCGAAATAAAACGGGTCGGATTAATAAAAATCATTGCCGAGGTTGGCTTTTGAATTTAGATGGGACACAGAGATTTTAAGCCGAGTAGG
ATAAAAGTAAATAGGTGCCAACACGTGGAGTATTCCGTTTGAGAGCACGGACTCGGATTAATTTTTGGACATAGATCGAACATCGAGAAATTGGATTCGGACACAGCTCGACTAGCAACT
GTCGAGCGCCTGATTAAATGAGCTTCAGACGAGATTTACAAATCGAGATTGATTATCGAGTTTGTATTCGTGTCGAGAAATAAAAGTTTTAATAGGCTCCAAAGTTGGCCTTCTGTGAGA
GTGAATAACTCCGAATTCGATGAAAGGTGAATGAATAGTCCGGATAATCAGAGACATACGCGAGTGAGAAATAAATTTTTTACTGAGCATCCGAGATTAGGATAAATCTCTCGATATAAC
ACGAAATAGACACCTGGGGTGTCACAAACCCCCCAATAGGAGCTAATAATAGGAAGAGCCCACTAATTTAGGAGCTGATATTATGATCACATTCTCATATATAGTCCAACCTTGAAAGAG
CATTATGATCACTTGAGGCTGGTCTTTGCTAAGCTTAGAGAACACAAGTTCTACCTGAAACACAAGAAGTGTTCCTTTGTGCAGCAGGAACTTCAGTATCTGGGGCATATCATTTCCAGA
AAAGGGGTAGCCGCTGACCCAGCCAAGGCAGCTGCTATGCTAGCCTGGCCACAGCCTCAGAATGTCACTGAGTTAAGAGTTTTCCTTGGGCTCACAGGCTAATACAGAAAATTTGTGAGG
AATTATGGGTTGCTAGCTAAACCCTTGACTGTTCTTCTGCAGAAACAAACATAGTTTTCAGTGGACAACTGCAGCACAATAGGCTTTTCATTCCCTGAAACAAGCTATGACCACTGTAGA
AGAGTGAACTCGATGTATTGCATAGAGGTGGACTACAATATATAGAGACACAGGAAACCCTAACCCTAATGGACCGGCAGCCCAACAGTGGTGCCGGCCCACACACACATAGTCTAACAT
CCCCCCGCAGTCGCAACGGGGGCACCACACACGATGAGACTGGAGTAGAGGCTGAAGGTAGGAGCCGACGGGTTGACCCCCCCCCCCCCCCCGCAGTCGCAGCGTCGTGATGGTGCGAAT
GTTGCGGCTGGAGTAGAGACCGTTGTGTGCTCCAAGAAGACGATAGCCCCTAGATGCCGAGGTAGCCGAAGTCGAGGTGGTCGCGGTCGGAAGACGCACAGCAAAAGCCTGATCTTCGGG
AGGGGTCGACGTTCGAGCGTCAACGATCGGCAGGGCGACACAGCAAAAGGGCACCGGCAGGCCGACCTGCTTCTTCGATCGACCAGACGTCAAGGAGCCCCGCCAGGGAGGCCGACAGCA
GCGCACGCGGCTGCGCCGATCATGGTGTCCGCGCCCGCGGCAGAAAAGAACGGGAATGTCGGATCCGGTCGGGAAGGCCACGGCAGCGACGGATCCGGACGGGAAGATGCGATTCAGCCA
AAGGGACGGCGGATCGAGCCGAAAAGGTCGCAGCAACGTGGATCCGGCCGGGAAGGCCGCGGCAGCGACGGATCCAATGAAGGGAGTAGGCGGCGGGGTGGGTCCAGCCAGGCAGGGGCC
TGCGCCGGACCTGGCAAGGGGTGTTGACGGCATCGGTGACAGGAAAAGCTCAAAGTGGGAGGCGCTGCTTGGGCGTCAACACGGGCAATTAGGAGGTGGCTAGCGCGATGACAAGGGGCT
GCAAAGCGCAGGAGCGGCCTGCTGGCCGGGCGGCGGCGGAAGAGAGGGTGCCGCTGCTAGGGGCGCCTGCTGTGGCGGCGGCGAGGCCACCCACGCCAGGAACAGAGACCGGCGAGGTCG
CCCGCGCCTACTGCAGCGGCAGCAAGGCCGAGGAGCTAGCCCGGCGACGAATCTGGGCAAACGTCTGGGTGTAGGGGGAGAGGCGATCGGAGATGGCGGCTGGTCTTAGGGCGAGCCCGA
GCGGGGCCTTGGCGGCCTGAGCGCCTGCACCGGGGAAGAAGGCCGCATGGAGGGGCTGCCGAGCAGTGGGAGATGAGGAGGAAGGGAGAGGTGAAGGCGCCGCGCCCCGGAGGGTGGACC
AGTCACGCGTCCTGGGCGTAGACCAGTCACGCGCTCGTGGAACTCGGCGACCGTCTTCTCGGCCGCCGCGGGCAGCGCCCCAGCGCGGCAGCGCGCCTGGGCGACGAAGACGAGGAACTC
CTCCTGGCACAACACGAAGGCCTCGAGCAGGCGGCGGATCTACGCGGCGGAGAGGAACTCCTCGCCTGCCCCGGCGGCGGCGTCGCTATGGCGGACCCGGTCCGAGCCCCGGCGGCCACG
GCGCGGCATGGTCTGGCCCTCGACGGCCTCGGCGCGGGCGCTCGCAGCCCCGCCAGGTCGTGAGGCGACGCGGCCGGGCAGGGAAGGTCGCGTGCACGCGCGGTCGTCCTGCGGCGGCGC
GGGCGCGCGGCCAGGCAGGAACTCCCCGCAGAGGGAGAGGCTGGAGACGCGGGCTGACGGAGCCCGCGTGGACCCGCAGCACCACCAGCGCCTTGCACGGCCCCGCCGGCGGGAAGGCGG
ACGGGGTGGGGGAAAGAGGGAGGCCTCGGCGGCCGAGGGAGAGTGCCGGCGGCTGGGGGCCAAAGGCTGGCAGCCGGCTGGGGAAGGGGTGGGGGTGCGGCTGCCTGCCCAGGGAGACAG
CGGCGGCGGCTGGGAGGAAGGAGGCCACCCCCGGGAGGGAAGGTTGGGCCTCCCGGGGGCAGCGATGGCAGGCGGCGGCTGGGTGGGAGGGAGCCGCCGGCGGCTGCGGTGGGAGAGAGA
GGAAGAAACCCTAAAACTAATTCTCTGATACCATGTAGAAGAGTGAACTCGATGTATTGCATAGAGGTGGACTACAATATATAGAGACACAGGAAACCCTAACCCTAATGGACCGGCAGC
CCAACAGTGGTGCCGGCCCACACACACTCACACACACATAGTCTAACAACCACCACACCTGTGCTAGCCTTACCCAGATTTGATTTGCTTTTTGTGATAGAAACTGATGCATGTGATGAT
GGCTTAGGAGCAGTCCTTATGCAGAAAGGGAGACCAATTGCTTTCATTAGCAAGGCTTTGGGCCAGAATAATAAGCACTTATCTATCTTTGAGAAGGAGTTCCTTGCATTAATCTTAGCT
GTAGATCGGTGCATAAGTCCCTTACCTTCCTAGGGGAGCAACACCTCCAATCAGACTTACAAACGAAAGCCATGACCAAACTGATGGACCTTCAATTTTAGATTGTTTACAAGAAAGGGT
CTGAAAACGTGGTTGCTGATGCACTTTCCAGGGTGGGTTCAGCCATGGAGTTGTCTGCTTTGTCTGAAGTGCAACCGGTTTGGATACAAGAAGTAGTCAATTCCTATATCACTGATGCTG
AAGCTCAGGAACTGCTGACCAAACTGCTAATCCAGAGCCCAGATGAGCAAGGCTTCTGTCTTCAACAAGGCATTATTAGGAGGGGCAGGCAAGTGTGGATTGGTGCAAACTCAGCTCTCA
GAACTAAGCTGATTTCAGCTTTGCATGCCAGTGCTAATTGGTGGACATTCTGGTGGGCCAACTACCTACCAGAGGGTGGGGAGACCTTTTATTGCAAAAGGCTCCAATCTGATGTTATGC
TATTTGTGCACCAGTGTCAACCCGTCAGCAAGCCAAGTCTGACAGGGTGCACCCAGCAGGCTTACTTCAACCATTACCTGTCCCTAGGGGAGCTTGGGAAGAAATTACAATGGATTTTAT
TGAGGGCTTGCCTAAATCTGAAGGTTTTGATATTATTCTGGTTGTGGTGGACAGGTTTACCAAGTTTGCACATTTTCTACCCTTAAAACATCCTTTCACTGCTCAAAAAGTGGCTCAAGT
TTTCTTGGATCAGATAGTGGAACCCCATGTGGCTCCAAAATCTATTGTTTCTGACAGAGATAAATTGTTTACTAGTCAGTTTTGGAGACATCTGTTTCAGTTGATGGATGTGCAACTTCT
GTTCTCTACTGCCTACCATCCACAAACAGATGGTCAGAGTGAGCGTGTCAATCAGTGTTTGGAGATGTCTTTAAGATGTGCAGTGAATGACCACCCTCAGAAATGGAAGGGCTGGTTAGC
TCTTGCAGTGTACTGGTATAATACCAGCTACCACTCTTCTTTGGGATGTACTCCATTCATAGTGATGTATGGCTATGATGCACCTGCTGTTGCTATACCTTGTTTGGCTCACTCTGATGA
TGTCGAGGTAAATCAGTGGCTTACTGACAGAGCTGCTTACTCAGCTATGCTCAAAGAACATTTGACTCGGGCTCAACATAGGATGAAACAGTTTGCCGACAAGGGCAGAACTCCAAGAGA
GTTTAGCATTGGGAACTTAGTGCTTCTAAAGTTGCAGTCGTATGCTCAGAAGACTGGTCAATCGACCCTGCCCAAAACTTGCCTTCAAGTTTTTTGGTCCTTTTCGGGTTCTGAACAAGG
TAGGGTCTATGGCTTATCGTTTCAGGTTCCTCAAGATGCTCAGGTTCATCCGGTGTTTCATGTGTCGCAACTTAAGCTGTTTCATCCAAGGTACACACCTGTGTTTGCTACTCTACCTCG
TGTGGCTGATTTATCTGTTGCTAGTGTGGAACCTGAAGATATTTCGGATCATCGCCTCGTCCACAAGAGGAATCAGGCTATCACTCTGTGATATCAAGTGGTCTCACCTTCCAGTGCAGA
CTGCTACATGGGAGGATGCTAATGTGGTCAAGGAGTGTTTTCCTGATGCAATCGCTTGGGGACAAGCGATATCCGCGCCCTGGGGACATGTCAGTGCCGACGAAGCCGGTGGATCAGAGG
AGCGGGTCTAAGTGCCCGAGAAGGAATAGTGTCTCAGGGTGTGAGTGTTTTGAATTTGGTCGTGTTGGGCTGTAATGAGCAGGTTGTAATGGGCCGTGTGGGCCGTGCAAGTGTTGGAGT
ATGAAACATGCTGTAAGACTTGGAAGAGGGGTATCCCAGAAATAATACAAACTGAAACGAACCAACCTTCCGGTTGTTCCGTATCCGGCGATCACCTGAGTTGTTCCCGAGCTCACGCCG
GCAACGCCGCGTCGGCCAGGGGCTGTGACACGATAGCACAATCTGTGTTATACAGTAACGTTGCCACTATCACAAACGTTTTTTTTTTTCAATTCCATAGAGAGATCGTGGAAAGCTGAC
ACAAGATACATGTTCTAGCTCAACTGGGATTTCCTCTGCTTTATTCATGTCATTATGTGGACTGTGGAATTGCTGAGAGGTGGGTAGGGTACCTCTGTATTCCTGTATGAGTTAGGACTT
AGGAGAAAGTATTTTATCCACTAATAGAAGGAAGTATATGGTGCTCACTTAGTAACAGCTTATGAGAAGCTCCAGTAGAGCACAATTTTGTAGAGGGCCAGTCAAACTGATATGGTGACT
AGTTTATATGTTGGAGTTCCCATTTTATATTTTTAGGTACATTGGGTTCCTCTATATGCCGTTGATCTGTAACCAGTTAAAAATCACACCAGTTTGACCTCCATTTGCTCTAGGATTCAG
CCAGGAATGTATTCTGCTTAATATGGATTGAGCTTACACCATTCTTCCCTTCATTCAATCATTGAAGACTTCTTTGCTCTCCCTTGCAGATGGCATGATGCTGGAACTTATGACCTGAAG
ACAAAAACTGGTGGTGCAAATGGTTCGATTAGATATGAAGAAGAGTACACTCATGGTTCAAATGCTGGTTTAAAGATTGCTATCGATCTCCTTG
GTATGCATCGGTTATACTCAATTATA
TTCTAGATGCCTATGAAAGAATATATTAACATATAAGTTAAGTACGGACTACTTGAATGAGGATTTCGAAGAAATCAATTTACACCGTTTTCTAGTTACTTCTCATAAACTGAAACTCCT
TTCCTGTGGCTGTGGGTTTTCTGCTATCTTCAAGGTCAGACAACAATATATTGGTTTTCGTGTCAATTGTTCTGGGATGATAAATTAAGAAAACTATGTAATGCTTTTAGCCGCTTAGGG
AAGAAGTCCTCTCATAAATATCTACTTGGTCAGAACTATTAGGTTCTAGGTCTATGCCCTGTCATGCAGACATGCAGTTAGACTATTATACGCACGACAATGGTTACCTGTATACCATTA
AGCCTTAAATGTAATATCGGGAGGTGTCTCAGTCAGAGCAATTGCAGTTTATGTGAATCCTACTACATTTGTATATCGTACTTCATGTGGAATGATGGTGATTTGTGTTTCTTGTTTTCT
TCTGTATTTCTTCACTGCTAAAATAAATGAAATCATTACTATTGCTTATTCAATTGTCTTTTGTTTTCCTCTAGAGCCTATCAAAGCAAAGAATCCAAAGATAACATATGCAGACCTGTA
TCAG
GTAATTTGGTATCACCTTCATTTTGCTCTTCTATAGGATGTTTGGCCTTCTCTAACCCTGTCGTGATTGGGCTTTTTTATCCTGTTGGGAACTGTGAAACTCTGGATTCAGTATAA
ATACTAACCTACATGGAATTTATAAACAGCTTGCTGGAGTGGTTGCAGTCGAAGTGACTGGGGGGCCAACTGTTGAATTTATTCCTGGCAGACGTGTATGTAAAAAAAACATTTCTTCGT
GATTGGATTCATCTTCCTGATGTTCACTCTTTAACTGGTTGACACTAATCAGGATTCGTCGGTGTGCCCCCGTGAAGGGCGTCTGCCAGATGCTAAGAAAGGTATTTACTACCTTGGGCT
ATACTTGTGTGATTGAATTGTAACATGTATCCTAACATTATTATTTTAACGTGGTTTTCTGGAAGTTTGAGAGGGAGGGAAGGAAGAATGGTACTTGTGTAATTCATGTGTAAAACTATC
TTGTTCCTGTCAGCATCGAACAGTTATGCATATCTGGGCTCCATGTTTGCCTGAAGTTTTATTAAACAACATAAGGGCTAGTTTGGGAACCTTATTTTCCCATGGGAAAATGAACTAATT
TCCCTTGGGAAAATGGGGTTCCCAAACTAGCCCTAAAAATTATTTTCTATTAGGAGCTGTTCCTGGTCCTGCCTTTATTTAACTAGTACTATATATAACATGTGTTTGTATCCAGCTTTG
GTATACTGATGGTTTGATGTCATTGTGTACTTATTATTTGATCATGTCTGTTGCTAATGTACATCTCTTGTTTTTTTGGATTCATTTCGTGAATAGGTGCACCACATCTGAGGGACATCT
TTTATCGGATGGGCTTATCGGACAAAGATATTGTAGCTCTATCAGGGGGACATACTCTG
GTAAATGGTTTGTCTCTGAAGGAGTACTCATTTGTTCATACGCACATCTTGAGACATTTGT
TCTTTTAGGGAAGGGCTCACCCTGAGAGGTCTGGATTCGATGGTGCCTGGACAAAGGAGCCTCTTAAGTTTGATAACTCATACTTTCTGTAAGTTGAACAAAGTCAGAATTTCTACTTGG
TTTACTGACTAGATTCCATATTAAACGAGGGTGCATTGTTACTGCAGTGAGCTGTTGAATGAGGAATCTGAGGGACTTTTAAAGCTCCCAACTGACAAGGCACTGTTATCAGATCCTGAA
TTTAGGCGCTATGTGGAGCTCTATGCAAAG
GTGAATAAGACTTATAGATATCCTTGTGCACAGCACACTTTAGCACCTTGTTTGATTATACAAGCTTCAGATCCACTGATTCAGAACCAT
GTCTTTGTTCGTACCGTAGGATGAAGATGCGTTCTTCAAAGATTATGCTGAATCACACAAGAAACTCTCTGAGCTTGGCTTCACGCCTCGCAGCACAGCACCATCCAAATCAGATCTTCC
AACCGCCGCCGTGCTTGCACAGAGTGCCTTTGGGGTAGCAGTTGCTGCAGCCGTAGTTATCGCTGGCTACTTGTACGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCCATGGTCGACGCCGAATACCTGCGCCAGGTCGACAGGGCGCGCCGCCACCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCGATCATGCTCCGCCTCGCATGGCAT
GATGCTGGAACTTATGACCTGAAGACAAAAACTGGTGGTGCAAATGGTTCGATTAGATATGAAGAAGAGTACACTCATGGTTCAAATGCTGGTTTAAAGATTGCTATCGATCTCCTTG
AG
CCTATCAAAGCAAAGAATCCAAAGATAACATATGCAGACCTGTATCAG
CTTGCTGGAGTGGTTGCAGTCGAAGTGACTGGGGGGCCAACTGTTGAATTTATTCCTGGCAGACGTGATTCG
TCGGTGTGCCCCCGTGAAGGGCGTCTGCCAGATGCTAAGAAAG
GTGCACCACATCTGAGGGACATCTTTTATCGGATGGGCTTATCGGACAAAGATATTGTAGCTCTATCAGGGGGACAT
ACTCTG
GGAAGGGCTCACCCTGAGAGGTCTGGATTCGATGGTGCCTGGACAAAGGAGCCTCTTAAGTTTGATAACTCATACTTTCTTGAGCTGTTGAATGAGGAATCTGAGGGACTTTTA
AAGCTCCCAACTGACAAGGCACTGTTATCAGATCCTGAATTTAGGCGCTATGTGGAGCTCTATGCAAAG
GATGAAGATGCGTTCTTCAAAGATTATGCTGAATCACACAAGAAACTCTCT
GAGCTTGGCTTCACGCCTCGCAGCACAGCACCATCCAAATCAGATCTTCCAACCGCCGCCGTGCTTGCACAGAGTGCCTTTGGGGTAGCAGTTGCTGCAGCCGTAGTTATCGCTGGCTAC
TTGTACGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA